ID: 1141398065

View in Genome Browser
Species Human (GRCh38)
Location 16:83722176-83722198
Sequence CTAATTATGTGAACCGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 44}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141398059_1141398065 24 Left 1141398059 16:83722129-83722151 CCACATGAAAGGTGCCCACAGTA 0: 1
1: 0
2: 1
3: 11
4: 99
Right 1141398065 16:83722176-83722198 CTAATTATGTGAACCGATGCTGG 0: 1
1: 0
2: 1
3: 2
4: 44
1141398063_1141398065 -7 Left 1141398063 16:83722160-83722182 CCAACTTCGCTGCCTGCTAATTA 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1141398065 16:83722176-83722198 CTAATTATGTGAACCGATGCTGG 0: 1
1: 0
2: 1
3: 2
4: 44
1141398061_1141398065 9 Left 1141398061 16:83722144-83722166 CCACAGTATTCAAATCCCAACTT 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1141398065 16:83722176-83722198 CTAATTATGTGAACCGATGCTGG 0: 1
1: 0
2: 1
3: 2
4: 44
1141398062_1141398065 -6 Left 1141398062 16:83722159-83722181 CCCAACTTCGCTGCCTGCTAATT No data
Right 1141398065 16:83722176-83722198 CTAATTATGTGAACCGATGCTGG 0: 1
1: 0
2: 1
3: 2
4: 44
1141398060_1141398065 10 Left 1141398060 16:83722143-83722165 CCCACAGTATTCAAATCCCAACT 0: 1
1: 0
2: 0
3: 23
4: 190
Right 1141398065 16:83722176-83722198 CTAATTATGTGAACCGATGCTGG 0: 1
1: 0
2: 1
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141398065 Original CRISPR CTAATTATGTGAACCGATGC TGG Intronic
923206793 1:231767024-231767046 CTAAGTATGAGAACAGATGGGGG + Intronic
1066041226 10:31549717-31549739 CTAATTATGTGAACCCAAACTGG - Intergenic
1102283546 12:111637004-111637026 CTAATGATGTAAACTGATACAGG + Intergenic
1102758050 12:115359638-115359660 CTAACTATGTTAACCCAGGCTGG - Intergenic
1105711574 13:23014482-23014504 CTAATTAAGTGAATCAATGCAGG - Intergenic
1106036386 13:26049138-26049160 CTCATTATGTGGACTGAGGCTGG - Intronic
1109256528 13:60089975-60089997 TTCATTATGTGAAGTGATGCAGG - Intronic
1111753950 13:92368818-92368840 CTAATTAAGTTAACTGAAGCCGG + Intronic
1119903209 14:78279362-78279384 AGAATCATGTGAACTGATGCAGG + Intronic
1135999381 16:27279772-27279794 CTAGTTATGTGAAACAATTCTGG - Intronic
1141398065 16:83722176-83722198 CTAATTATGTGAACCGATGCTGG + Intronic
1145368206 17:22282973-22282995 ATAATTATGTGAGATGATGCTGG - Intergenic
1151258953 17:72901789-72901811 TTGATTATGGGAACAGATGCTGG + Intronic
930440790 2:51402960-51402982 TTACTTATGTGAAGCCATGCAGG + Intergenic
943155623 2:184171443-184171465 ATCATTATGTGAACAGATGATGG + Intergenic
947604512 2:231476048-231476070 ATAATTATCTCAACAGATGCAGG + Intronic
1169531387 20:6488927-6488949 CTAATTATGTCAAAGGAAGCTGG + Intergenic
1170787052 20:19476758-19476780 ATAATTATGGGAACCCAGGCAGG + Intronic
1179523062 21:41957948-41957970 CTAATAATGTGAACTGCTTCAGG - Intergenic
951242467 3:20303069-20303091 CTAATTATCTGAAGGGATACGGG + Intergenic
951720500 3:25692721-25692743 CTAATTAACTCAACAGATGCTGG - Intergenic
960948349 3:122982285-122982307 CTGATTTTGTGAACCAGTGCTGG - Intronic
965717522 3:171622522-171622544 ATAATTATTTTAACAGATGCTGG + Intronic
973203091 4:47527668-47527690 ATAATTTTGTGAAAAGATGCAGG + Intronic
973307917 4:48674321-48674343 CTAATTATGTGATCCAAGACTGG - Intronic
976916802 4:90386126-90386148 CTAATTCTGTGAACAAATGATGG - Intronic
988088769 5:26507789-26507811 ATAATTATTTGCACAGATGCAGG - Intergenic
990390936 5:55320035-55320057 CTACTTATGTGAACCTCTTCTGG - Intronic
993523942 5:88941413-88941435 CTATGTATGTAAACCTATGCAGG + Intergenic
996409780 5:123145122-123145144 CTAATCATTTAAACCAATGCTGG - Intronic
999122408 5:149219410-149219432 TTACTTATATGAACTGATGCTGG + Intronic
1011955525 6:93020424-93020446 CTAATTCTGTGAAATGATGTTGG - Intergenic
1013212230 6:107997393-107997415 ATTATTATGTAAACCCATGCTGG - Intergenic
1013307881 6:108866665-108866687 CTAGTTATGTGAACTTGTGCAGG - Intronic
1014370929 6:120606737-120606759 CTATTAATGTTAACTGATGCTGG - Intergenic
1017197933 6:151722230-151722252 CTGATTGTGTGCACCGATGGTGG + Intronic
1021903154 7:25307916-25307938 CTTATTATATCAACCGGTGCTGG + Intergenic
1024368084 7:48546137-48546159 CTATTATTGTGAACAGATGCAGG - Intronic
1030745811 7:113164843-113164865 CTAACTAGGTGAATGGATGCTGG - Intergenic
1040490239 8:47913930-47913952 CTAATTCTGTGACTCGAGGCAGG + Exonic
1051518209 9:17954335-17954357 CTAATTCTTTGAACCTAGGCTGG - Intergenic
1059708574 9:116846581-116846603 CTAATTATCTGAATATATGCTGG + Intronic
1186472654 X:9833502-9833524 CTAATTAGGAGGTCCGATGCAGG - Intronic
1188673409 X:32908835-32908857 CCAATTATGTGAACCTATGCTGG + Intronic
1190926576 X:54911818-54911840 CAGATTATGTCAACCGATGAGGG - Intergenic
1193995550 X:88363120-88363142 CTAATTTGGTGAACAGTTGCGGG + Intergenic
1199641606 X:149867855-149867877 CTGATTATGTGAGCCTATTCTGG + Intergenic
1199768189 X:150955827-150955849 GTAAGTATGTGAAGAGATGCTGG + Intergenic