ID: 1141400487

View in Genome Browser
Species Human (GRCh38)
Location 16:83742876-83742898
Sequence TCCCATGGGAGACCTCAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141400487_1141400493 6 Left 1141400487 16:83742876-83742898 CCTCCTTGAGGTCTCCCATGGGA 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1141400493 16:83742905-83742927 ACCAAACAAAATAAGCAAACTGG 0: 1
1: 0
2: 1
3: 72
4: 852
1141400487_1141400497 19 Left 1141400487 16:83742876-83742898 CCTCCTTGAGGTCTCCCATGGGA 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1141400497 16:83742918-83742940 AGCAAACTGGCCAGGTGCGGTGG 0: 1
1: 18
2: 162
3: 1349
4: 7653
1141400487_1141400496 16 Left 1141400487 16:83742876-83742898 CCTCCTTGAGGTCTCCCATGGGA 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1141400496 16:83742915-83742937 ATAAGCAAACTGGCCAGGTGCGG No data
1141400487_1141400495 11 Left 1141400487 16:83742876-83742898 CCTCCTTGAGGTCTCCCATGGGA 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1141400495 16:83742910-83742932 ACAAAATAAGCAAACTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141400487 Original CRISPR TCCCATGGGAGACCTCAAGG AGG (reversed) Intronic
900092690 1:927326-927348 TCCTGGGGGAGCCCTCAAGGGGG - Intronic
900715293 1:4140201-4140223 GCCCATGGGAGCCCTTGAGGGGG - Intergenic
904066991 1:27760574-27760596 CTCCATGACAGACCTCAAGGAGG + Exonic
907939362 1:59072672-59072694 TCCCTTGGGATACCTCATGATGG + Intergenic
908206803 1:61858787-61858809 TTGCATGGGAGACCAAAAGGTGG + Intronic
909026495 1:70487574-70487596 TCCCATAGCAGATCCCAAGGGGG + Intergenic
912706938 1:111921621-111921643 GCCTGTGGGAGACCTAAAGGTGG - Intronic
913790765 1:122522071-122522093 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913790874 1:122524110-122524132 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913792784 1:122558791-122558813 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913793266 1:122567293-122567315 TTCCAAGGAAGGCCTCAAGGAGG - Intergenic
913804807 1:122775018-122775040 TTCCAACGGAGGCCTCAAGGAGG - Intergenic
913806351 1:122802563-122802585 TTCCATGGAAGGCCTCAAGGAGG - Intergenic
913814983 1:122957596-122957618 TTCCAAGGAAGGCCTCAAGGAGG - Intergenic
913817113 1:122995328-122995350 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913821175 1:123067707-123067729 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913837973 1:123368657-123368679 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913838936 1:123385982-123386004 TTCCATCGAAGACCTCAAGGAGG - Intergenic
913842020 1:123440699-123440721 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913844728 1:123489809-123489831 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913858802 1:123743548-123743570 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913869474 1:123934380-123934402 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913887993 1:124265832-124265854 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913893373 1:124362049-124362071 TTCCAAGGAAGGCCTCAAGGAGG - Intergenic
913894499 1:124382448-124382470 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913905885 1:124586881-124586903 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913910765 1:124674244-124674266 TTCCAACGAAGACCTCAAGGAGG - Intergenic
913916052 1:124769068-124769090 TTCCAACGAAGACCTCAAGGAGG - Intergenic
915744869 1:158148105-158148127 GCCGATGGGAAACCTCTAGGGGG + Intergenic
915974753 1:160377879-160377901 TCCCATGGGGGCTCTCAAGCTGG - Intergenic
916917989 1:169430819-169430841 TCCAATGGGAAACCTCTAGTGGG - Intronic
920186513 1:204162656-204162678 TGCCATGGGAGGCCGCTAGGTGG + Intronic
920218289 1:204377292-204377314 TCACATGCGAGGCCTCCAGGAGG - Intronic
922068432 1:222167203-222167225 TACCATGGGTGGCCTCCAGGTGG - Intergenic
1062792394 10:316754-316776 TCCCAGGGGAGTCCTAAAAGTGG - Intronic
1066524446 10:36261133-36261155 TGCCATGGGAGGACTCAAAGTGG + Intergenic
1066824040 10:39540081-39540103 TTCCAAGGAAGACCTCAAAGTGG - Intergenic
1066841822 10:39931604-39931626 TTCCAAGGAAGACCTCAAAGAGG - Intergenic
1068310338 10:55266465-55266487 GCCCATGGGAGCCCTCACGAGGG - Intronic
1068868176 10:61916832-61916854 GTCAATGGAAGACCTCAAGGAGG - Intronic
1071000802 10:80828448-80828470 TCCCATAGCAGATCCCAAGGGGG + Intergenic
1071504947 10:86226653-86226675 TCCAATGGGAAAACTGAAGGTGG - Intronic
1072042995 10:91627218-91627240 CTCCATGGGAGATTTCAAGGAGG + Intergenic
1077045965 11:545280-545302 TCACCAGGGACACCTCAAGGTGG - Intronic
1077721728 11:4637059-4637081 TCCCCTGTGCGACCACAAGGTGG + Intergenic
1078387874 11:10908862-10908884 GCCAATGGGAAACCTCTAGGGGG + Intergenic
1078657327 11:13253878-13253900 TCCCATGGGAGAATCCTAGGAGG + Intergenic
1079099667 11:17533369-17533391 CCCCATAGCAGACCTCAGGGAGG + Intronic
1082936423 11:58661487-58661509 GCCAATGGGAGACCTCTAGGGGG - Intronic
1084711066 11:70844045-70844067 TCCCATCTGAGTCCCCAAGGTGG + Intronic
1085768902 11:79307877-79307899 CCACATGGGAGACCTCAACTTGG + Intronic
1089294415 11:117459251-117459273 TCCCATGGGAGAGCCCAGAGTGG + Intronic
1089719273 11:120397439-120397461 TCCCAAGGAAGAAATCAAGGGGG + Intronic
1090332407 11:125942204-125942226 AGCCAGGGGAGGCCTCAAGGGGG + Intergenic
1091229576 11:133979268-133979290 TCCCATGAGAGACCCCAGGCCGG + Intergenic
1092864663 12:12749697-12749719 GCCCATGGGAAACCTGTAGGGGG + Intronic
1094879271 12:34697832-34697854 TTCCATCGAAGACCTCAAAGAGG - Intergenic
1094985137 12:36477960-36477982 TTCCAACGGAGGCCTCAAGGAGG - Intergenic
1094997852 12:36683340-36683362 TTCCAAGGAAGACCTCAAAGAGG - Intergenic
1095012311 12:36918270-36918292 TTCCAAGGAAGACCTCAAAGAGG - Intergenic
1095487021 12:42695764-42695786 GCCAATGGGAAACCTCTAGGAGG + Intergenic
1098313270 12:69168637-69168659 GCCAATGGGAGACCTCTAGAGGG + Intergenic
1099285861 12:80713933-80713955 TCCCAGGGGAGACCTGGAAGGGG - Intergenic
1102416368 12:112766478-112766500 TCCCATGGGAGACTGGCAGGGGG + Intronic
1104739231 12:131160773-131160795 TCCCATGGTGGACATCAATGGGG + Intergenic
1105267180 13:18831080-18831102 TCCCAAGGCAGACATCAAAGTGG + Intergenic
1108399230 13:50022510-50022532 ACCCATGGGAGACAGCAATGTGG + Intergenic
1112436169 13:99392705-99392727 ACCCATGGGAGCTCTCCAGGCGG - Intergenic
1112638622 13:101245961-101245983 GCCAATGGGAAACCTCTAGGGGG + Intronic
1113312311 13:109142773-109142795 GCCAATGGGAAACCTCTAGGGGG + Intronic
1117896812 14:60495816-60495838 AGCCATGGAACACCTCAAGGTGG - Intronic
1121429378 14:93876201-93876223 GCCAGTGGGAGACCTCTAGGGGG + Intergenic
1202831581 14_GL000009v2_random:40371-40393 TCCCAAGGTAGACATCAAAGTGG - Intergenic
1125215114 15:37263231-37263253 TCCAATGAGAGAGCTCAATGAGG - Intergenic
1126301055 15:47196398-47196420 TCCCTTGGGAGACCTCCTGGAGG + Intronic
1129119456 15:73387154-73387176 GCCCATGGGACACTTCCAGGGGG + Intergenic
1129200675 15:73997084-73997106 GCCAATGGGAAACCTCTAGGGGG - Intronic
1129276211 15:74447401-74447423 GCCCATGGGAGGCTTTAAGGAGG - Intronic
1129459029 15:75690629-75690651 GCCCATAGGGGACCTCTAGGGGG + Exonic
1130213446 15:81946962-81946984 GCCAATGGGAAACCTCTAGGGGG + Intergenic
1130924625 15:88375718-88375740 GCCCTTGGGAGACCTGATGGGGG + Intergenic
1132232314 15:100193247-100193269 GCTCCCGGGAGACCTCAAGGAGG - Intronic
1133075173 16:3274633-3274655 GCCAATGGGAAACCTCTAGGGGG - Intronic
1133136653 16:3717185-3717207 GCCCATGGGAGCCCTGAAGGAGG - Intronic
1135688478 16:24517176-24517198 TCTCATGGGAGTCCACTAGGGGG + Intergenic
1137573192 16:49579800-49579822 TCCCATGGGAGGGCACAGGGAGG + Intronic
1138129227 16:54465311-54465333 GCCAATGGGAAACCTCTAGGGGG - Intergenic
1139634017 16:68247147-68247169 AGCCCTGGGAGACCTCACGGTGG + Intronic
1141400487 16:83742876-83742898 TCCCATGGGAGACCTCAAGGAGG - Intronic
1144306036 17:13970355-13970377 GCCAATGGGAAACCTCTAGGGGG + Intergenic
1146444969 17:32926487-32926509 GCCAATGGGAAACCTCTAGGAGG + Intergenic
1148819381 17:50351788-50351810 TCCCATGTGAGATGTCAAGGAGG + Intronic
1152134727 17:78497215-78497237 TTCCAGAGGAGACCTCAAGCAGG - Intronic
1152918382 17:83053008-83053030 TCTCCTGGGGGACCTCACGGTGG - Intergenic
1153485688 18:5595491-5595513 CCCTAGGGTAGACCTCAAGGTGG - Intronic
1160162437 18:76483869-76483891 TCACATGGCAGCGCTCAAGGAGG - Intronic
1160236941 18:77093248-77093270 TCCCAGGGGCCACCTCGAGGGGG + Intronic
1160956048 19:1692127-1692149 CCCTATGGGAGACCCCAAAGCGG - Intergenic
1163006942 19:14402814-14402836 CCCCATCGGAGGACTCAAGGTGG - Exonic
1163110011 19:15154156-15154178 TCCCACTGGAGACCTCTGGGTGG + Intergenic
1163510842 19:17734111-17734133 ACCCATTGCAGACCTCAAGGTGG + Intronic
1164828454 19:31301635-31301657 TGCCATGGGAGGCCTGAGGGTGG - Intronic
1165941360 19:39416279-39416301 CTCCATGGGAGGCCTCCAGGAGG - Intronic
1166050712 19:40257198-40257220 TCCCAGAGGAGCCCTCCAGGTGG + Intronic
1167538509 19:50070774-50070796 TGAGATGGGAGACCTGAAGGAGG + Intergenic
1202641121 1_KI270706v1_random:87384-87406 TCCCAAGGTAGACATCAAAGTGG + Intergenic
929875747 2:45795085-45795107 CCCCGTGGGGGACCTCAAGAAGG - Intronic
930266741 2:49209229-49209251 TCCCATGGAAGATCTCCATGGGG + Intergenic
931101621 2:59008366-59008388 TCCCAAGGGAGAAATCTAGGAGG - Intergenic
933941108 2:87245876-87245898 TCCCAGGGAAGACCCCTAGGGGG + Intergenic
934496922 2:94810788-94810810 TCCCAAGGTAGACATCAAAGTGG + Intergenic
936039196 2:109136615-109136637 TCCTTTGGGAGACCTGAAGGAGG + Intronic
936352033 2:111720136-111720158 TCCCAGGGAAGACCCCTAGGGGG - Intergenic
936953464 2:118001617-118001639 TCCTATAGAAGACCACAAGGTGG + Intronic
941250986 2:163162171-163162193 GCCAATGGGAAACCTCAAGAGGG - Intergenic
941802036 2:169670748-169670770 ATCCATGGGAGACAGCAAGGAGG + Intronic
942759610 2:179382952-179382974 TCCCACAGCAGATCTCAAGGGGG + Intergenic
945992248 2:216405844-216405866 CCCCAGGGGAGACCTGAAGGAGG - Intergenic
947447813 2:230177944-230177966 GCCCATGGGTGACTTCCAGGTGG + Intronic
947539960 2:230969565-230969587 GCCAATGGGAAACCTCTAGGGGG + Intergenic
1171194981 20:23189842-23189864 GACCATGAGAGACCTCCAGGTGG + Intergenic
1171727820 20:28641794-28641816 TCCCAGGGGAGATTTCAAGATGG - Intergenic
1173978770 20:47207091-47207113 TGCAGTGGGACACCTCAAGGTGG + Intergenic
1174428888 20:50453198-50453220 TACCAGGAGAGACATCAAGGGGG + Intergenic
1174504925 20:51010971-51010993 TGCCATGGGAGCACTCAGGGAGG + Intronic
1174532601 20:51225884-51225906 GCCAATGGGAAACCTCTAGGGGG - Intergenic
1175861821 20:62154512-62154534 TCCCAACGGAGACCTCTGGGGGG - Intronic
1175989744 20:62782399-62782421 GCCAATGGGAAACCTCTAGGGGG + Intergenic
1176610769 21:8885203-8885225 TCCCAAGGTAGACATCAAAGTGG - Intergenic
1176852242 21:13929610-13929632 TCCCAAGGCAGACATCAAAGTGG + Intergenic
1178039816 21:28627954-28627976 TCCAATGGGAAACCTCTAGAGGG + Intergenic
1180008633 21:45035054-45035076 TTCCAGGGGAGACATCAAGGCGG - Intergenic
1180360840 22:11894488-11894510 TCCCAAGGTAGACATCAAAGTGG - Intergenic
1182177530 22:28306497-28306519 TCTCATGGGAGATTTCATGGCGG + Exonic
1185247053 22:49778574-49778596 TCCCATGGGGGACCTCATCGGGG - Intronic
955867492 3:63400564-63400586 TCCCAGGAGAGAGATCAAGGAGG + Intronic
956650327 3:71498956-71498978 ACCCATGGGAGAGGTCAAGGTGG - Intronic
958054240 3:88388808-88388830 TTCCATGGAAGACCTCATTGTGG - Intergenic
958266808 3:91447336-91447358 ACCAATGGGAGACCTCTAGAGGG - Intergenic
959675665 3:109032456-109032478 ACCCATGGGAGACCACAACCTGG - Intronic
961467677 3:127091461-127091483 TCAGCTGGGAGACCTGAAGGCGG + Intergenic
962903247 3:139779075-139779097 TCCCAGGGGGCACCTCAAAGCGG + Intergenic
966101107 3:176269830-176269852 TCCCATAGCAGATCTCAAAGGGG - Intergenic
967509055 3:190288792-190288814 TCCCATAGCAGATCCCAAGGGGG - Intergenic
967864633 3:194180213-194180235 TCCCAAGGGAGAGACCAAGGTGG - Intergenic
1202737449 3_GL000221v1_random:20007-20029 TCCCAAGGTAGACATCAAAGTGG - Intergenic
971636960 4:29073205-29073227 TCCCATAGAAGACCCCTAGGTGG - Intergenic
972746104 4:41934351-41934373 GCCAATGGGAAACCTCTAGGGGG + Intergenic
973384631 4:49497915-49497937 TCCCAAGGTAGACATCAAAGTGG + Intergenic
982123608 4:152165167-152165189 TCCCATGGAAGAACTAAAGTTGG + Intergenic
982282674 4:153701323-153701345 TCACATGGGAGAACGCAAGAGGG - Intergenic
983564143 4:169131958-169131980 TCCAATGGGAAACCTCTAGAGGG + Intronic
1202768482 4_GL000008v2_random:173234-173256 TCCCAAGGTAGACATCAAAGTGG + Intergenic
989128869 5:38084200-38084222 TCCCATGGGAGACATCAAGCTGG - Intergenic
989907302 5:47277486-47277508 TTCCAACGGAGACCTCAAAGAGG - Intergenic
990181146 5:53162199-53162221 TGCCATGTGAGGACTCAAGGAGG - Intergenic
990487950 5:56277786-56277808 TCCCAGGGGAGCCCTGAAGCTGG + Intergenic
990702146 5:58485312-58485334 TCCCATGGGAGAATAAAAGGCGG + Intergenic
995844231 5:116476763-116476785 TTGCATGGGAACCCTCAAGGTGG - Intronic
999399161 5:151251216-151251238 GCCAATGGGAAACCTCTAGGGGG - Intronic
1202773799 5_GL000208v1_random:41244-41266 TTCCAAGGAAGACCTCAAAGTGG + Intergenic
1003467312 6:6392980-6393002 GCCCATGGGAGATCTCCATGGGG + Intergenic
1008988403 6:57574260-57574282 ACCAATGGGAGACCTCTAGAGGG + Intronic
1009064957 6:58448567-58448589 TTCCAAGGAAGGCCTCAAGGAGG - Intergenic
1009078034 6:58731115-58731137 TTCCAACGAAGACCTCAAGGCGG - Intergenic
1009082960 6:58799876-58799898 TTCCAAGGAAGGCCTCAAGGAGG - Intergenic
1009152732 6:59770528-59770550 TTCCAAGGAAGGCCTCAAGGAGG - Intergenic
1009177014 6:60472849-60472871 ACCAATGGGAGACCTCTAGAGGG + Intergenic
1009909079 6:69904029-69904051 TGCTATGGCAGCCCTCAAGGAGG - Intronic
1010855463 6:80832990-80833012 TACTATGGGAGACCTGAAGCTGG + Intergenic
1011804776 6:91059971-91059993 TCCCCTAGGAGATCCCAAGGGGG - Intergenic
1017392557 6:153957587-153957609 ACCCATGGGAAACCTCTAGAGGG + Intergenic
1017826261 6:158084282-158084304 TCCCAGGAGAGACCTCAACCAGG + Intronic
1018327011 6:162681773-162681795 GCCAATGGGAAACCTCTAGGGGG + Intronic
1018851986 6:167647293-167647315 CACCATGGGAGCCCTGAAGGTGG - Intergenic
1023109273 7:36793622-36793644 TCCCAGGGAAGACATGAAGGTGG + Intergenic
1023516083 7:41003218-41003240 TGCCATGGGAGACCACTAGGTGG + Intergenic
1023742506 7:43293342-43293364 GCCAATGGGAAACCTCTAGGGGG - Intronic
1024051741 7:45628072-45628094 TCACCTGGGACACCTTAAGGTGG + Intronic
1024493396 7:50013347-50013369 TTCCATGGGAGAGCTCATGAAGG + Intronic
1025249060 7:57339611-57339633 TCTCAAGGGAGACCTCAGTGTGG + Intergenic
1026845976 7:73699462-73699484 TCCCATGAGAAGCCCCAAGGTGG + Exonic
1027934936 7:84589808-84589830 TGCCATGGGAGACCTTTAGGAGG + Intergenic
1030115974 7:106062613-106062635 GCCTATGGGAAACCTCTAGGGGG - Intergenic
1030973425 7:116090308-116090330 GCCCATGGGAAATCTCTAGGGGG + Intronic
1034443663 7:151101008-151101030 GGCCATGGGGGACCTGAAGGTGG - Intronic
1034564070 7:151899564-151899586 CCCAATGGGAGAGGTCAAGGAGG - Intergenic
1036462902 8:8969939-8969961 GCCAATGGGAAACCTCTAGGGGG - Intergenic
1038906199 8:31906111-31906133 TCACATGGGAGACCTTGAGTTGG - Intronic
1041284482 8:56246070-56246092 TTCCATGGGATATCTCATGGGGG + Intergenic
1042912162 8:73838939-73838961 GCCAATGGGAAACCTCTAGGGGG + Intronic
1049219535 8:141422563-141422585 TCCCCTGGGAGGCCTGCAGGGGG + Intronic
1051574109 9:18595413-18595435 TCCCATAGCAGATCTCAAGGGGG - Intronic
1052875095 9:33553432-33553454 TCCCAAGGCAGACATCAAAGTGG - Intronic
1053500925 9:38590892-38590914 TCCCAAGGCAGACATCAAAGCGG + Intergenic
1053538536 9:38949637-38949659 TCCCAGTGATGACCTCAAGGTGG + Intergenic
1053660226 9:40269656-40269678 TCCCAAGGCAGACATCAAAGCGG - Intronic
1053910603 9:42899010-42899032 TCCCAAGGTAGACATCAAAGTGG - Intergenic
1054372358 9:64415957-64415979 TCCCAAGGCAGACATCAAAGCGG - Intergenic
1054524372 9:66106563-66106585 TCCCAAGGCAGACATCAAAGCGG + Intergenic
1054627602 9:67414282-67414304 TCCCAGTGATGACCTCAAGGTGG - Intergenic
1054679977 9:67905655-67905677 TCCCAAGGCAGACATCAAAGCGG - Intergenic
1057680334 9:97175400-97175422 TCCCAAGGCAGACATCAAAGTGG + Intergenic
1060530944 9:124346726-124346748 TCACAGGGGACTCCTCAAGGGGG - Intronic
1203693376 Un_GL000214v1:67097-67119 TCCCAAGGTAGACATCAAAGTGG + Intergenic
1203339169 Un_KI270303v1:1694-1716 TTCCAACGGAGGCCTCAAGGAGG + Intergenic
1203417847 Un_KI270362v1:1201-1223 TTCCAAGGAAGACCTCAAAGCGG + Intergenic
1203421740 Un_KI270521v1:7065-7087 TCCCAGGGGAGATTTCAAGATGG + Intergenic
1203706175 Un_KI270742v1:50451-50473 TCCCAAGGTAGACATCAAAGTGG - Intergenic
1203557825 Un_KI270744v1:15463-15485 TCCCAAGGTAGACATCAAAGTGG + Intergenic
1203642897 Un_KI270751v1:36966-36988 TCCCAAGGTAGACATCAAAGTGG - Intergenic
1186078650 X:5907341-5907363 TCCGATGAGAGACTTCAAAGAGG - Intronic
1188282666 X:28289517-28289539 GCCAATGGGAAACCTCTAGGGGG - Intergenic
1192566565 X:72169050-72169072 GCCAATGGGAAACCTCTAGGGGG - Intergenic
1194965616 X:100285463-100285485 TGCCTTTGGAGACCTCAAGAGGG + Intergenic
1196872776 X:120128416-120128438 GCCAATGGGAAACCTCTAGGGGG - Intergenic
1198102513 X:133434352-133434374 GCCAATGGGAAACCTCTAGGGGG - Intergenic
1198385404 X:136124339-136124361 GCCAATGGGAAACCTCTAGGGGG + Intergenic
1202370017 Y:24189885-24189907 GCCCATAGGGGACCTCTAGGGGG + Intergenic
1202500767 Y:25480232-25480254 GCCCATAGGGGACCTCTAGGGGG - Intergenic