ID: 1141400489

View in Genome Browser
Species Human (GRCh38)
Location 16:83742879-83742901
Sequence TCCTCCCATGGGAGACCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 6, 3: 15, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141400489_1141400496 13 Left 1141400489 16:83742879-83742901 CCTTGAGGTCTCCCATGGGAGGA 0: 1
1: 0
2: 6
3: 15
4: 152
Right 1141400496 16:83742915-83742937 ATAAGCAAACTGGCCAGGTGCGG No data
1141400489_1141400495 8 Left 1141400489 16:83742879-83742901 CCTTGAGGTCTCCCATGGGAGGA 0: 1
1: 0
2: 6
3: 15
4: 152
Right 1141400495 16:83742910-83742932 ACAAAATAAGCAAACTGGCCAGG No data
1141400489_1141400497 16 Left 1141400489 16:83742879-83742901 CCTTGAGGTCTCCCATGGGAGGA 0: 1
1: 0
2: 6
3: 15
4: 152
Right 1141400497 16:83742918-83742940 AGCAAACTGGCCAGGTGCGGTGG 0: 1
1: 18
2: 162
3: 1349
4: 7653
1141400489_1141400493 3 Left 1141400489 16:83742879-83742901 CCTTGAGGTCTCCCATGGGAGGA 0: 1
1: 0
2: 6
3: 15
4: 152
Right 1141400493 16:83742905-83742927 ACCAAACAAAATAAGCAAACTGG 0: 1
1: 0
2: 1
3: 72
4: 852

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141400489 Original CRISPR TCCTCCCATGGGAGACCTCA AGG (reversed) Intronic
900302186 1:1983396-1983418 TCCTCTCATGGGACACGTGATGG - Intronic
900488641 1:2935451-2935473 TCCTCCCATGGGCGCCTTCAAGG - Intergenic
902610240 1:17592865-17592887 CCCTCCCATGGGGGACTCCATGG - Intronic
902901145 1:19517004-19517026 TCCTCCCATGGGAAACAGTAAGG + Intergenic
903352615 1:22727140-22727162 TCCTCCCATGCCAGGCTTCATGG - Intronic
904388867 1:30165995-30166017 GCCTCCCTTGAGGGACCTCAGGG + Intergenic
905352728 1:37358780-37358802 TCCAGCCAGGGGAGACTTCAGGG + Intergenic
907563097 1:55409376-55409398 TTCTACCATGTGAGAACTCAAGG - Intergenic
916665434 1:166962652-166962674 TACTCCCAGGGCAGACCTCTCGG - Intronic
919824194 1:201492254-201492276 TCAGCCCAGGGCAGACCTCAGGG + Intronic
920676180 1:208040127-208040149 TGTTCTCTTGGGAGACCTCATGG - Intronic
922803869 1:228375912-228375934 TGTTCCCATGGGTGGCCTCAGGG + Intronic
922804397 1:228378061-228378083 TCCACCCGAGGGTGACCTCAGGG + Intronic
922892964 1:229075660-229075682 TGCTCCCAGGGGAGACTTCCTGG - Intergenic
1064340057 10:14477719-14477741 TCCCCCCATGACAGTCCTCATGG + Intergenic
1072122435 10:92416088-92416110 TCATACCATGGGAGACTCCATGG + Intergenic
1073758141 10:106603193-106603215 TGCTCCCCTCGGAGTCCTCAGGG - Intronic
1074687979 10:115977306-115977328 CCCTCCCAAAGGAGACCCCAGGG - Intergenic
1075190926 10:120307937-120307959 TAATCCCAAGGGAGATCTCAAGG + Intergenic
1076129271 10:128001697-128001719 TCATCCCATGGCAGACCCCTAGG - Intronic
1076197844 10:128532846-128532868 TCCTCCCATGACAGACCTAGTGG - Intergenic
1076551137 10:131278829-131278851 CCCTCCCATGGGAGCTCTCCTGG + Intronic
1076682842 10:132183280-132183302 TCCTCCTCTGGGAGAGCTCCTGG + Exonic
1077168694 11:1156786-1156808 TCCTCCCATGGGAGACCTTCTGG + Intergenic
1077168847 11:1157536-1157558 TCCTCCCATGGCCGACCTCCTGG - Intergenic
1078436698 11:11331294-11331316 TCCTCCCATGAGTGTCCCCATGG - Intronic
1079639940 11:22792675-22792697 TCCTCCCTACGGAGACCTCTGGG + Intronic
1079803218 11:24896581-24896603 TCCCCCCATGGGATACCGCATGG + Intronic
1081458081 11:43245058-43245080 TCCTCCCATGGAAGACGTGGGGG + Intergenic
1081759161 11:45564960-45564982 TCTTCCCCTGGGTGACGTCAAGG - Intergenic
1081905085 11:46664055-46664077 TCCTGCCATGGGGACCCTCAGGG - Exonic
1084223097 11:67696911-67696933 TCCTCCCACAGGAGGGCTCAAGG - Intergenic
1087786515 11:102361037-102361059 TTCTCCCATGGGAGACATTGTGG + Intronic
1089571990 11:119417214-119417236 TCCTCCCCTTGGAGAGCTCTGGG + Intergenic
1089620681 11:119720505-119720527 TGCTCCCATGGGGGGCCACACGG - Intronic
1090501521 11:127265835-127265857 TCCTCCTATGGGAGACACCGTGG + Intergenic
1098087455 12:66862385-66862407 TCCTCCCATGGAATACTTCTTGG + Intergenic
1101320603 12:103669899-103669921 TCCTCCTGTGGGAGATATCAGGG + Intronic
1102477655 12:113199286-113199308 TCCTCCCATCTCAGCCCTCATGG - Intronic
1103020993 12:117534166-117534188 TGCTCTCTTGGGAGGCCTCAGGG - Intronic
1104766273 12:131332473-131332495 CCCTCCCATGGGTGACATCTGGG + Intergenic
1104848452 12:131858884-131858906 GCCTCCCCTGGAAGCCCTCAAGG - Intergenic
1104995068 12:132649214-132649236 CCCTCCCATCCCAGACCTCAGGG + Intronic
1113077831 13:106485401-106485423 TCCTCCTATGAGGGAACTCACGG - Intergenic
1113414469 13:110117589-110117611 AGCTCCCATGGGAGACAGCAGGG - Intergenic
1113681813 13:112249812-112249834 TCCTACCTTGTGTGACCTCAGGG + Intergenic
1116651737 14:47602674-47602696 TCCTGCCATTGGAGGCCTCAAGG - Intronic
1118744093 14:68761614-68761636 CCCTCCCATGGGTGTCCTCTTGG - Intergenic
1122825321 14:104367836-104367858 TCTTCCCATAGGAAGCCTCAGGG + Intergenic
1123492993 15:20797948-20797970 CCCTCCCCTGAGAGACTTCAGGG - Intergenic
1124021680 15:25931204-25931226 TTCCCCCATGGGAGAACTTATGG + Intergenic
1126740846 15:51774790-51774812 TCCTCCCAGGGGTTGCCTCATGG + Intronic
1127303411 15:57679684-57679706 CCCTCCCATGGTAGTCCACATGG + Intronic
1128788111 15:70413175-70413197 TTCTCCCATGGGAGTCCTAAAGG + Intergenic
1130578608 15:85115345-85115367 TCCTCCCACAGGACAACTCAGGG - Intronic
1133136655 16:3717188-3717210 CCCGCCCATGGGAGCCCTGAAGG - Intronic
1137021483 16:35432500-35432522 ACCTCCCAATGAAGACCTCAAGG + Intergenic
1140864716 16:79050021-79050043 TCCTCCCATTCCAGACCTCCAGG - Intronic
1141400489 16:83742879-83742901 TCCTCCCATGGGAGACCTCAAGG - Intronic
1141623849 16:85251261-85251283 TCCTCCCACGGATGCCCTCAAGG + Intergenic
1142032416 16:87845173-87845195 GCCACCCAGGGGAGACCTCCCGG + Intronic
1142066658 16:88066840-88066862 TGCTCCCTTGGGAGACTTGAGGG + Intronic
1145720827 17:27071012-27071034 GCCTCCCATGGGTGACCTCGGGG - Intergenic
1148464315 17:47855874-47855896 TCCTTTCCTGGCAGACCTCACGG - Intronic
1149854985 17:60074651-60074673 CTCTCCCATGTGAGACCTAAGGG + Intronic
1152111847 17:78360958-78360980 CCCTCCCCTAGGAGACCCCAGGG - Intergenic
1155264047 18:24074065-24074087 TCATGCCCTGGGAGAACTCATGG + Intronic
1161841231 19:6681904-6681926 TCCTCCCCTGGGAGGCTTCCAGG - Intronic
1163510840 19:17734108-17734130 ACCACCCATTGCAGACCTCAAGG + Intronic
1163570301 19:18077623-18077645 GCCTCCTCTGGGAGACATCAAGG - Exonic
1164159686 19:22618150-22618172 TCCACCCCTGCGCGACCTCAGGG + Intergenic
1164722088 19:30439757-30439779 ACTGCCCATGGGAGACCCCAGGG - Intronic
1164726684 19:30470073-30470095 TCCTCCCAGGTGAGTCCTGAGGG + Intronic
1164828456 19:31301638-31301660 ACCTGCCATGGGAGGCCTGAGGG - Intronic
1166035501 19:40165277-40165299 TACTCCCATAGCAGACCTCTTGG + Intergenic
1166269552 19:41705595-41705617 TCCTCCCAGGTGACACATCAGGG + Intronic
1166419598 19:42626236-42626258 TCCTGTCATGGGAGACCTCAGGG - Intronic
1166947153 19:46404360-46404382 CCCTTCCTTGCGAGACCTCAGGG - Intergenic
1166995946 19:46719814-46719836 TCTACCCATGGGCGACCCCATGG + Exonic
1168515657 19:57008616-57008638 ACCCTCCCTGGGAGACCTCACGG - Intergenic
925876992 2:8320024-8320046 TCCTTCCATGGGATACATCAGGG + Intergenic
926037438 2:9646515-9646537 CCCTGCCTTGGGAGAGCTCATGG - Intergenic
929516869 2:42611405-42611427 TCCTGCCATGGAAGATCTCTGGG - Intronic
929914899 2:46126752-46126774 CCCTCCCATGGGACTGCTCAAGG - Intronic
935736696 2:106112010-106112032 TCCTCCCAAGGGAGGCCAGAGGG + Intronic
936953462 2:118001614-118001636 TCCTCCTATAGAAGACCACAAGG + Intronic
941706648 2:168665448-168665470 TCGTCCCATGGGAGATCTCATGG + Intronic
946013899 2:216588589-216588611 TCTTCCCTTGGGAAACCTCCAGG + Intergenic
1171059311 20:21940765-21940787 TAATCCCACTGGAGACCTCATGG + Intergenic
1173225386 20:41159630-41159652 TCCGCCCAGGGAAGACCTCACGG + Exonic
1173850818 20:46216619-46216641 TCCTACCAAGGAAGACCCCAGGG - Intronic
1175735867 20:61386537-61386559 TCTTCCCATCAAAGACCTCAAGG - Intronic
1175850238 20:62086729-62086751 TCCACCCATGGGATCCCTCGAGG + Intergenic
1177714658 21:24823336-24823358 TCCTCCCATGGGAAACCGCAAGG - Intergenic
1178243032 21:30924275-30924297 TGTTCCCATGGGAGCCCTAAGGG - Intergenic
1178268933 21:31171846-31171868 ACCTCCCATGAGAGACCCCAAGG + Intronic
1180005781 21:45019778-45019800 TCCTCACCTGGGAGACCGCATGG + Intergenic
1182177528 22:28306494-28306516 ACCTCTCATGGGAGATTTCATGG + Exonic
1183068405 22:35379597-35379619 TCCTCCCAAGGGTGAGCTAAGGG - Intergenic
1185162501 22:49238338-49238360 TCCTCACCTGGGAGACGTGAGGG - Intergenic
950579391 3:13852624-13852646 TGCTGCCATGGGACACCCCAAGG - Intronic
954066609 3:48111724-48111746 TCGTACCATGGGGGACCACACGG - Intergenic
954962467 3:54578478-54578500 TCCTCCCGAGGGGGACCCCAAGG - Intronic
955579066 3:60399428-60399450 TCCTCCCATGGCAGTCATTATGG - Intronic
958806706 3:98819742-98819764 TCCTCCCAGGGAAGACCTCAGGG - Intronic
962618074 3:137148633-137148655 TCCTTCCCTGGGAGATCCCAGGG + Intergenic
966909506 3:184551169-184551191 TCCTCTCACGGGAGCCCTCCAGG - Intronic
969015372 4:4100300-4100322 TCCTGCCATTTGAGACCACATGG + Intergenic
969700717 4:8766205-8766227 TCCTCCCATGCCAGTCCCCAAGG + Intergenic
969797779 4:9539614-9539636 TCCTGCCATTTGAGACCACATGG - Intergenic
969841549 4:9886732-9886754 TCATCCCATGAGAGAGCACATGG + Intronic
970265202 4:14275215-14275237 TCCTCCCATGACAGACTTCTTGG + Intergenic
974751792 4:66151807-66151829 CCCATCCATGGGTGACCTCATGG - Intergenic
977191777 4:94009872-94009894 TCCTCCCATGCCAAAACTCAAGG - Intergenic
980195593 4:129584030-129584052 TCACCCCATGGGAGAAATCATGG - Intergenic
985286778 4:188344296-188344318 TCCTTCCATAGGAAACCCCAGGG - Intergenic
987062877 5:14258990-14259012 TCCTCCCTTGGATTACCTCAGGG - Intronic
994559261 5:101346730-101346752 TCCTCCCATGGAAGTGGTCATGG - Intergenic
994909179 5:105880405-105880427 TCCTACCATTGGAAATCTCAGGG - Intergenic
995177065 5:109190687-109190709 ACCTCTCACTGGAGACCTCATGG - Exonic
996759353 5:126971578-126971600 CCCTCCCATGGGTGATCTCTGGG - Intronic
1000982391 5:167829843-167829865 TCCCACCATGGGATTCCTCATGG - Intronic
1001678149 5:173535607-173535629 GTATACCATGGGAGACCTCAGGG + Intergenic
1002423523 5:179162863-179162885 TCCTCCTTTGGGGGACCACAGGG + Intronic
1002669540 5:180855528-180855550 TATTCCCCTGGGAGCCCTCATGG + Intronic
1007306026 6:40905651-40905673 TCCACTCAGGGGAAACCTCAAGG - Intergenic
1007952492 6:45884774-45884796 TCCCCACATGGGAGGCCACATGG - Intergenic
1009699700 6:67160709-67160731 TCTTCCCATCAGAGACCTGAAGG + Intergenic
1010447663 6:75966376-75966398 TCATGACATGGGAGTCCTCATGG - Intronic
1011591600 6:88975446-88975468 ACCTCCAAAGGGATACCTCATGG - Intergenic
1012873318 6:104696722-104696744 TCCTCTGATGGGAGGCCTTATGG - Intergenic
1014514192 6:122361513-122361535 TACTACCATGGCAGCCCTCAGGG + Intergenic
1016522530 6:144962671-144962693 TCCTCCCATGGTAGAAAACAGGG - Intergenic
1016765108 6:147783945-147783967 GCCTGCCATTGGAGTCCTCAGGG + Intergenic
1017032064 6:150233038-150233060 TCTGCCCATGGGACATCTCATGG + Intronic
1017386390 6:153889824-153889846 TACACCCATTGGAGACCTCAAGG + Intergenic
1018506556 6:164476348-164476370 TACACGCATTGGAGACCTCAAGG - Intergenic
1019552111 7:1608291-1608313 TCCTCCCATGGGGGATCCCGGGG + Intergenic
1024474170 7:49792779-49792801 TCCTCCCTGGGGAAGCCTCATGG + Intronic
1024896033 7:54263450-54263472 TGGTGCCAAGGGAGACCTCATGG - Intergenic
1025150139 7:56541143-56541165 TCCATCCATGGGTGACCTGATGG - Intergenic
1026455818 7:70571733-70571755 TCCTCCCCTTGCACACCTCATGG - Intronic
1027934934 7:84589805-84589827 GCCTGCCATGGGAGACCTTTAGG + Intergenic
1028294040 7:89105427-89105449 TCATACCATGGGTGACCACATGG + Intronic
1028319114 7:89438149-89438171 TACTGCCATGGCAGCCCTCAGGG + Intergenic
1029824161 7:103172598-103172620 TTCTAACATGGGAGATCTCAAGG - Intergenic
1033335978 7:140452620-140452642 TACTCCCATGGAAGACCTTCAGG - Intergenic
1034429476 7:151033996-151034018 GCCTCTCAGGGGAGAGCTCAGGG + Intronic
1035175175 7:157045264-157045286 TCCACCCAAGGGCCACCTCAAGG - Intergenic
1035557377 8:577358-577380 TTCTCCCATGGCAGAGCTCTGGG + Intergenic
1037382610 8:18303339-18303361 TCCCCCCATAGGAGTCCCCAGGG + Intergenic
1037973901 8:23195809-23195831 ACATACCATGGGTGACCTCATGG - Intronic
1045596933 8:103667812-103667834 TACACCCATTGGAGACCTTAAGG - Intronic
1046735220 8:117769069-117769091 AGCTCCCATGGCTGACCTCAAGG - Intergenic
1047857270 8:128925064-128925086 TTCTGCCATGTGAGAACTCAGGG + Intergenic
1048351634 8:133621248-133621270 TGCTCCCATCTGAGCCCTCAGGG + Intergenic
1048631097 8:136243345-136243367 TCCTTCCATTGTTGACCTCAAGG + Intergenic
1053549186 9:39057443-39057465 TCCTGCCATGGGGTACCACAAGG - Intergenic
1053813314 9:41877527-41877549 TCCTGCCATGGGGTACCACAAGG - Intergenic
1054283671 9:63144570-63144592 TCCTCCTCTGGGAAACCTCCTGG - Intergenic
1054391148 9:64620368-64620390 TCCTCCTCTGGGAAACCTCCTGG + Intergenic
1054617282 9:67309912-67309934 TCCTGCCATGGGGTACCACAAGG + Intergenic
1057216246 9:93230425-93230447 TCCTCCCAGGGCACAGCTCAGGG + Intronic
1059504786 9:114788641-114788663 TCCTATCCTGGGAGACCTCATGG - Exonic
1059588052 9:115627626-115627648 TCCTCGCATGGACCACCTCAGGG - Intergenic
1060005004 9:119992063-119992085 CCCTCCCATGTGAGACCTCAGGG - Intergenic
1060473778 9:123970339-123970361 TCCTCTCAAGGGAGAGCCCAAGG + Intergenic
1062253342 9:135609097-135609119 TCCTCCCCTCGGAGAGCCCAGGG + Intergenic
1191963981 X:66735971-66735993 TCCTCTCATTGGTGACCACATGG - Intergenic
1194411313 X:93562102-93562124 TCTTCCCATGGGAGACATCGAGG - Intergenic
1195095335 X:101496228-101496250 TCCACCCCTGGGAGACATCAAGG + Intronic
1195101151 X:101555103-101555125 TCCACCCCTGGGAGACATCAAGG + Intergenic
1195178407 X:102333308-102333330 GCCTGCCATGGGAGACTGCATGG + Intergenic
1195180457 X:102353775-102353797 GCCTGCCATGGGAGACTGCATGG - Intergenic