ID: 1141400491

View in Genome Browser
Species Human (GRCh38)
Location 16:83742890-83742912
Sequence TGTTTGGTGCCTCCTCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141400491_1141400497 5 Left 1141400491 16:83742890-83742912 CCCATGGGAGGAGGCACCAAACA 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1141400497 16:83742918-83742940 AGCAAACTGGCCAGGTGCGGTGG 0: 1
1: 18
2: 162
3: 1349
4: 7653
1141400491_1141400496 2 Left 1141400491 16:83742890-83742912 CCCATGGGAGGAGGCACCAAACA 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1141400496 16:83742915-83742937 ATAAGCAAACTGGCCAGGTGCGG No data
1141400491_1141400493 -8 Left 1141400491 16:83742890-83742912 CCCATGGGAGGAGGCACCAAACA 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1141400493 16:83742905-83742927 ACCAAACAAAATAAGCAAACTGG 0: 1
1: 0
2: 1
3: 72
4: 852
1141400491_1141400495 -3 Left 1141400491 16:83742890-83742912 CCCATGGGAGGAGGCACCAAACA 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1141400495 16:83742910-83742932 ACAAAATAAGCAAACTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141400491 Original CRISPR TGTTTGGTGCCTCCTCCCAT GGG (reversed) Intronic
900322890 1:2093774-2093796 TGTACGGTGCCTCCTCCCTGCGG + Intronic
900484734 1:2916922-2916944 TTTGTGGTGCCTCCTCCTCTGGG + Intergenic
902925978 1:19695896-19695918 TCTTGGGTGCCTCCTCCCTATGG + Intronic
903665900 1:25007263-25007285 TGTTTGTTTCCTCCTTCCCTAGG - Intergenic
904093538 1:27960895-27960917 TGTTTGGTTGCTGTTCCCATTGG + Intronic
908520811 1:64940084-64940106 TGTGTAGTGCCTGCTCTCATAGG - Intronic
915736354 1:158087984-158088006 TCTGTGTTGCCTCCTCCCCTAGG + Exonic
920798456 1:209163357-209163379 TGTTTGGTGCCTGCCCACATTGG - Intergenic
922803608 1:228374895-228374917 TGTGTGGTGCCTGGCCCCATAGG - Intronic
923219199 1:231877608-231877630 TTTCTGGTTCCTCTTCCCATTGG + Intronic
1064335839 10:14440577-14440599 TGTCTGATGCCTCCTTCCTTTGG + Intronic
1068713733 10:60163025-60163047 AGTTTGGCGTCTCCTCCCAAGGG - Intronic
1068742818 10:60493388-60493410 ATGTTGCTGCCTCCTCCCATAGG - Intronic
1069504831 10:68988650-68988672 TGATTGCTGCGTCTTCCCATTGG + Intergenic
1071292795 10:84199803-84199825 TGTTTGCTCCCTCCTGCAATGGG + Intronic
1076114620 10:127886659-127886681 GGTTTGCTCCCTTCTCCCATGGG - Intronic
1079738667 11:24030229-24030251 TGTTTTGTTCCTTCTACCATGGG - Intergenic
1080422827 11:32126842-32126864 TGCTGTGTGCCTGCTCCCATGGG - Intergenic
1083110262 11:60399624-60399646 TGTTTGTAGCCTCCTCTCATTGG - Intronic
1084616887 11:70242463-70242485 TCTTTTGGGCCTTCTCCCATGGG - Intergenic
1084703933 11:70804935-70804957 TGTTTAGTGCCCACTCCCATGGG + Intronic
1085425900 11:76404487-76404509 TGCTTGCTGTCTACTCCCATAGG - Exonic
1087588443 11:100152636-100152658 TGTTTAGTGCCTCCTTCTAAAGG + Intronic
1089680304 11:120115601-120115623 GCTTTGCTGCCTCCTCCCTTTGG - Intronic
1091646768 12:2278109-2278131 TATTTGGTGACTCCACCCATTGG - Intronic
1091676623 12:2495639-2495661 TGTGTTGTGCCTTCTCCCCTGGG + Intronic
1093810956 12:23491517-23491539 TTTTTGATGCCTCCCACCATTGG - Intergenic
1101001833 12:100364599-100364621 TGTTTTGTGCCTCTTCCAAGTGG + Intronic
1102090528 12:110183666-110183688 TACTTAGTGCCTACTCCCATAGG + Intronic
1103278627 12:119735078-119735100 TGCTTGGTGCGTTCTCCCAAGGG - Intronic
1104802904 12:131566816-131566838 TCTCTGATGCCTCCTCCCACGGG + Intergenic
1105748488 13:23399653-23399675 TGTTTGGTGTGTTCTCCCAGTGG + Intronic
1106387591 13:29302668-29302690 TGGTGGCTGCCTCCTCCCACAGG - Intronic
1113418975 13:110155196-110155218 TGTCTGGTGCCTCCACACCTTGG - Intronic
1113514581 13:110883637-110883659 TGTTTGGTGTCTTCAACCATTGG + Intronic
1115780009 14:36758659-36758681 TCATTGCTGCTTCCTCCCATTGG - Intronic
1118744095 14:68761625-68761647 GGTTTGGGGCTCCCTCCCATGGG - Intergenic
1119618439 14:76113564-76113586 TGTTTGCTGTCTCCTCCCTCAGG - Intergenic
1120136762 14:80878656-80878678 AGTGTGGTGCCTGCTCCCATGGG + Intronic
1120214614 14:81668736-81668758 TCTGTGGTGCCTGGTCCCATCGG - Intergenic
1121928644 14:97952022-97952044 GTTTTGGTGACTTCTCCCATAGG + Intronic
1122307257 14:100773715-100773737 CCTCTGGTGCCTCCTCGCATGGG + Intergenic
1126071045 15:44864966-44864988 TGATTGGTTCCCCATCCCATGGG + Intergenic
1131150303 15:90043379-90043401 TGGCTGTGGCCTCCTCCCATAGG - Intronic
1132788830 16:1673590-1673612 TGTTGGGTGTCTTCCCCCATAGG + Intronic
1132928649 16:2446954-2446976 GGTTTGCTCCCTCCTTCCATGGG - Intronic
1137757354 16:50913163-50913185 AGTTTGGTGCCATCACCCATTGG - Intergenic
1141271164 16:82542459-82542481 TATTTTGTGCCTCCTCCTTTTGG + Intergenic
1141400491 16:83742890-83742912 TGTTTGGTGCCTCCTCCCATGGG - Intronic
1145165816 17:20612772-20612794 TGTCTGGGGCCTCCTCCCCAGGG - Intergenic
1146507277 17:33416420-33416442 TCTTCTCTGCCTCCTCCCATGGG + Intronic
1147120884 17:38334497-38334519 TGTTGGGGGCCTCCTCACCTGGG + Intronic
1147654420 17:42080681-42080703 GGCTTTGTGCCTCCTCCCACCGG - Intergenic
1148006860 17:44439566-44439588 TGTTTGGTGTCTTTTCCCACTGG - Intronic
1148646566 17:49222834-49222856 TGTTCTGTCCTTCCTCCCATCGG + Exonic
1149257865 17:54847722-54847744 TGTTTTGAGCCTCCTCCATTAGG + Intergenic
1149398283 17:56267335-56267357 TGTTGGGTGCATTCTCCCCTTGG + Intronic
1152361835 17:79836453-79836475 TGACCGGTGCCTCCGCCCATGGG - Intronic
1153578974 18:6551844-6551866 TGTTTCTTCCCTCCTCCTATAGG + Intronic
1155220201 18:23678241-23678263 TGGATGGTGCCTGCTCACATGGG + Intergenic
1163596211 19:18222391-18222413 TGTCTGGTGCGTCCTCCCTGGGG + Intronic
1165224542 19:34345296-34345318 TGTTTTGTGCTTGCTCCCCTTGG + Intronic
1165503162 19:36206272-36206294 TGTTGGTTGTCTCTTCCCATAGG - Intronic
1167964020 19:53128917-53128939 TGTTTTGTGTCTCCCTCCATTGG - Intronic
937642384 2:124228300-124228322 TGGATGGTGCCTGCTCACATTGG + Intronic
940033432 2:149288805-149288827 ATTTTGGTGCCTCCTGCCAGAGG + Intergenic
946411340 2:219516765-219516787 TGTCTGGGGCCTCCCGCCATTGG + Intronic
946517967 2:220434013-220434035 TGTTTGTGGAGTCCTCCCATTGG + Intergenic
947078651 2:226371050-226371072 TGTTTGTTGCCTTATCACATAGG + Intergenic
948157038 2:235791884-235791906 TCTTTGGTGTCTCCACCCAAAGG - Intronic
948653691 2:239464220-239464242 TGTTTGGACCCTCCTCTCCTGGG + Intergenic
1170273835 20:14560661-14560683 TGTTTTCTGCATCCTCCCATAGG + Intronic
1170480554 20:16760961-16760983 TGGTTGGTGCCTGATCCCACAGG + Intronic
1170804117 20:19615088-19615110 GGTTTGATTCCTTCTCCCATTGG + Intronic
1171279724 20:23885778-23885800 TATTTGGTGCCTCCTGCCACAGG - Intergenic
1173128265 20:40360721-40360743 AGTTTGGTGCCTCCTAGCAAAGG + Intergenic
1173231312 20:41201085-41201107 TGTTTGGTACCTCATCCCCAGGG - Intronic
1173274394 20:41566763-41566785 TGTGTGGTGTCTCCTCCCGCAGG + Intronic
1176521353 21:7826904-7826926 TGTTTCCTGCCACCTCCCAGGGG + Intronic
1177282564 21:19002299-19002321 TGTTTGGTTCCTCCTCGGTTAGG + Intergenic
1177809690 21:25912653-25912675 TATTTGGTGTCTGCTCACATTGG - Intronic
1178655373 21:34456916-34456938 TGTTTCCTGCCACCTCCCAGGGG + Intergenic
1182896564 22:33863880-33863902 TGTCTGGGGCCTGCTCCCATTGG + Intronic
1183003741 22:34883041-34883063 GGATTGGTGCCTCCACCAATGGG - Intergenic
1183145499 22:35987690-35987712 TGATTGCTGCCTCCTCTCATGGG - Intronic
949339495 3:3013506-3013528 TGTTTGGGAGCTCCTGCCATGGG + Intronic
950724574 3:14907983-14908005 TATTTGGTGCTTCCTCTCCTTGG - Intronic
953054076 3:39373525-39373547 AGTGTGGTGGCTCCTCTCATAGG - Intergenic
955868250 3:63408725-63408747 TGGATGGTGCCTGCTCACATGGG + Intronic
956707673 3:72013272-72013294 TCTGTGCTGCCTCCTCCCATGGG - Intergenic
962449677 3:135502560-135502582 TGGGTCGTGCCACCTCCCATGGG - Intergenic
963623873 3:147646529-147646551 TGTTTACTGCCTCCTTCCAAAGG - Intergenic
967647349 3:191941906-191941928 ACTTTGGTGACTTCTCCCATTGG - Intergenic
970439071 4:16064434-16064456 TGTCTCCTGCCTCCTCCCAAGGG - Intronic
978564250 4:110065064-110065086 TGTTTGTTGTCTCCTGCAATAGG - Intronic
981480351 4:145232596-145232618 TGTTCGGTTCCTGCTTCCATAGG + Intergenic
984316423 4:178137488-178137510 TGTTGGCTCCCTCATCCCATAGG - Intergenic
985818578 5:2144849-2144871 TGTAGGGAGCCTCCTACCATAGG - Intergenic
988011871 5:25498943-25498965 TGTTTGCTGCCTCCTTGCTTGGG + Intergenic
995249921 5:109981399-109981421 GGTTTGGTTCCTCCTCCTTTAGG + Intergenic
996372055 5:122763899-122763921 TTATTGGACCCTCCTCCCATTGG + Intergenic
1001263119 5:170249831-170249853 TGCTAGGTGCCTCCCTCCATGGG + Intronic
1002164257 5:177334853-177334875 TGTCTGGTGGCTCCTGCCCTTGG - Intronic
1002552005 5:180001631-180001653 TGTATGGTGCTTCATTCCATGGG - Intronic
1008071667 6:47104599-47104621 TGTTTGATGCCTCCTCCTCAAGG - Intergenic
1009351940 6:62691332-62691354 TGTTTAATGACTACTCCCATGGG + Intergenic
1010007270 6:71009995-71010017 TGTGTGGTACCTCATCCCTTGGG - Intergenic
1010170459 6:72969471-72969493 TTAGTGGTGCCTCCTCCCCTAGG + Intronic
1010791944 6:80075138-80075160 TATATGGTGCCTCATCCCCTGGG - Intergenic
1017589072 6:155959164-155959186 TCTTTTCTGCCTCCTCCCAGGGG + Intergenic
1018275514 6:162126230-162126252 TGTTTAGTGCTGCTTCCCATTGG - Intronic
1020112188 7:5453557-5453579 TGTTCTGTGTCTCCTCCCAAAGG + Intronic
1021355112 7:19644670-19644692 TGCTTGATGCCTCCTGCCCTTGG + Intergenic
1022567857 7:31421345-31421367 TGTTTGGTTCCTCAAACCATTGG - Intergenic
1024002105 7:45196857-45196879 TGTGTGGTCCCTCCTGCTATTGG - Intergenic
1024200072 7:47097632-47097654 TGTTTGGCTCCTCCCCACATAGG + Intergenic
1026323006 7:69283819-69283841 TCTTTGGGGCCTGGTCCCATGGG - Intergenic
1026452384 7:70540592-70540614 TGTTTGGTGGCTCCCCACTTGGG + Intronic
1028915536 7:96254790-96254812 TTTTTGGTTTCTCCTCCCACAGG - Intronic
1029706624 7:102279846-102279868 TGGCTGGTGCCTCCTGCCACAGG - Intronic
1032096623 7:128941400-128941422 TGTTTGGTGCCTGCTGTCATTGG + Intronic
1033443782 7:141402970-141402992 TGTTTGGGGCCTGCTTCCATAGG - Intronic
1035588879 8:798218-798240 TGATGGGTGCCTGCTTCCATTGG + Intergenic
1038228460 8:25678710-25678732 TTTTTTGTGCATCTTCCCATTGG - Intergenic
1038251395 8:25908241-25908263 CGGTTGGTGCCTCTCCCCATAGG + Intronic
1038572953 8:28678822-28678844 TGTTTGGTGTCTTAGCCCATGGG + Intronic
1039469644 8:37805250-37805272 GGTCTTTTGCCTCCTCCCATGGG - Intronic
1040535705 8:48307735-48307757 TGTTTTGTGCTTCCACCCAAAGG - Intergenic
1043543438 8:81288850-81288872 TATTAGGTCCCACCTCCCATCGG + Intergenic
1046672328 8:117069847-117069869 TGTTTGGGCCATCTTCCCATAGG - Intronic
1047568618 8:126073472-126073494 TGTTTGTTTCCTCCTTCCAAGGG - Intergenic
1049676789 8:143892893-143892915 AGGTTGGTGCCTCCTGCCCTGGG - Intergenic
1055450128 9:76423405-76423427 TTTTTGCTGCATCATCCCATGGG - Intronic
1058164038 9:101600659-101600681 TGTTTTGTTCCTCCTGCCCTAGG - Intronic
1060385455 9:123222751-123222773 GGTTTGGTGCCTTCTCCTTTTGG - Intronic
1062235890 9:135507403-135507425 TGTTTGGGCCGTCCTCCCTTTGG + Intergenic
1190092847 X:47454907-47454929 TTCTTTATGCCTCCTCCCATGGG - Intronic
1191053255 X:56216809-56216831 TGTATGGTCCCTCCTGCCACAGG + Intergenic
1193570922 X:83141847-83141869 TGTTTGGTTCCTCATCCTAAGGG - Intergenic