ID: 1141400492

View in Genome Browser
Species Human (GRCh38)
Location 16:83742891-83742913
Sequence TTGTTTGGTGCCTCCTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141400492_1141400496 1 Left 1141400492 16:83742891-83742913 CCATGGGAGGAGGCACCAAACAA No data
Right 1141400496 16:83742915-83742937 ATAAGCAAACTGGCCAGGTGCGG No data
1141400492_1141400495 -4 Left 1141400492 16:83742891-83742913 CCATGGGAGGAGGCACCAAACAA No data
Right 1141400495 16:83742910-83742932 ACAAAATAAGCAAACTGGCCAGG No data
1141400492_1141400493 -9 Left 1141400492 16:83742891-83742913 CCATGGGAGGAGGCACCAAACAA No data
Right 1141400493 16:83742905-83742927 ACCAAACAAAATAAGCAAACTGG 0: 1
1: 0
2: 1
3: 72
4: 852
1141400492_1141400497 4 Left 1141400492 16:83742891-83742913 CCATGGGAGGAGGCACCAAACAA No data
Right 1141400497 16:83742918-83742940 AGCAAACTGGCCAGGTGCGGTGG 0: 1
1: 18
2: 162
3: 1349
4: 7653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141400492 Original CRISPR TTGTTTGGTGCCTCCTCCCA TGG (reversed) Intronic
No off target data available for this crispr