ID: 1141400493

View in Genome Browser
Species Human (GRCh38)
Location 16:83742905-83742927
Sequence ACCAAACAAAATAAGCAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 926
Summary {0: 1, 1: 0, 2: 1, 3: 72, 4: 852}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141400489_1141400493 3 Left 1141400489 16:83742879-83742901 CCTTGAGGTCTCCCATGGGAGGA 0: 1
1: 0
2: 6
3: 15
4: 152
Right 1141400493 16:83742905-83742927 ACCAAACAAAATAAGCAAACTGG 0: 1
1: 0
2: 1
3: 72
4: 852
1141400492_1141400493 -9 Left 1141400492 16:83742891-83742913 CCATGGGAGGAGGCACCAAACAA No data
Right 1141400493 16:83742905-83742927 ACCAAACAAAATAAGCAAACTGG 0: 1
1: 0
2: 1
3: 72
4: 852
1141400491_1141400493 -8 Left 1141400491 16:83742890-83742912 CCCATGGGAGGAGGCACCAAACA 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1141400493 16:83742905-83742927 ACCAAACAAAATAAGCAAACTGG 0: 1
1: 0
2: 1
3: 72
4: 852
1141400487_1141400493 6 Left 1141400487 16:83742876-83742898 CCTCCTTGAGGTCTCCCATGGGA 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1141400493 16:83742905-83742927 ACCAAACAAAATAAGCAAACTGG 0: 1
1: 0
2: 1
3: 72
4: 852

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141400493 Original CRISPR ACCAAACAAAATAAGCAAAC TGG Intronic
901654393 1:10761104-10761126 ACCTAATAAAAGAAGCAAACAGG + Intronic
901827565 1:11872337-11872359 ACCAAAAAAAAAAAACAAAACGG - Intergenic
901975045 1:12937694-12937716 ACTTAAAAAAACAAGCAAACAGG + Intronic
902010130 1:13264070-13264092 ACTTAAAAAAACAAGCAAACAGG - Intergenic
902095689 1:13942890-13942912 AGCAAAGAAGATAAGCAACCTGG + Intergenic
902129568 1:14247816-14247838 ACCCAAAAAAAAAAGCAAAAAGG - Intergenic
902290295 1:15430882-15430904 ACAAAACAAAACAAAAAAACAGG + Intergenic
903065829 1:20698836-20698858 ATCAAAATAAATAAGCAAAATGG + Intronic
903265993 1:22158346-22158368 ACAAAACAAAACAAAAAAACAGG + Intergenic
903480299 1:23648257-23648279 AACAAACAAAAAAAGAAAATGGG - Intergenic
903524869 1:23985955-23985977 AACAAACAAAAAAAAGAAACTGG - Intergenic
903561899 1:24234280-24234302 ACAAAACAAAATCAGCACATAGG - Intergenic
903731895 1:25502636-25502658 AATAAACAAAATAAGTAAAAAGG - Intergenic
903754769 1:25653064-25653086 ACAAAACAAAACAAAAAAACAGG - Intronic
904060193 1:27703202-27703224 ACCAAACAAAATATCAAACCAGG - Intergenic
904170133 1:28585928-28585950 AACAAACAAAAAAAAAAAACAGG + Intergenic
904671297 1:32167868-32167890 ACAAAAAAAAACAAGCAAGCTGG + Intronic
905576583 1:39049510-39049532 AACAAACAAAAAAAACAAAAAGG - Intergenic
906082868 1:43105592-43105614 AACAAACAAAATAGACAAATTGG - Intergenic
906498575 1:46323216-46323238 ACAAAACAAAACAAATAAACTGG + Intergenic
906950512 1:50331490-50331512 ACCAAACAAAAGAGGGAAGCTGG + Intergenic
906981765 1:50638801-50638823 AGCAAACTAACTTAGCAAACTGG - Intronic
907023923 1:51096003-51096025 ACCAAACAAACTAAGGCACCAGG + Intergenic
907377996 1:54060110-54060132 ACCAAAAAAAATTAGCAGCCAGG + Intronic
907670076 1:56466596-56466618 CCAAAACAAAATACACAAACTGG + Intergenic
908080506 1:60572770-60572792 ACAACACAAAATAAGAAAGCAGG + Intergenic
908616049 1:65924066-65924088 AAAAAAAAAAATTAGCAAACTGG - Intronic
909130959 1:71736893-71736915 ACCAAACTAAAAATGCCAACTGG + Intronic
909199907 1:72677855-72677877 AACAAAAAAAAGAAGCAAACAGG + Intergenic
909231147 1:73092536-73092558 AACAAACTAAATAAGCCACCAGG - Intergenic
909309204 1:74124373-74124395 ACCAAACAAAATTAGACAAATGG - Intronic
909462814 1:75938515-75938537 ACAAAACACAAAAAACAAACAGG - Intergenic
909617038 1:77622318-77622340 AACAAACAAAATAAACTAAAAGG + Intronic
910573792 1:88736308-88736330 AACAAACAAAATAAGGCACCAGG - Intronic
910613243 1:89167462-89167484 ACCAAACAAAATATTAAACCAGG - Intronic
910733555 1:90426174-90426196 ACAAAACAAAACAAAAAAACTGG + Intergenic
910973625 1:92882642-92882664 AGCAAAGAAAATGAACAAACTGG - Intronic
911011151 1:93282182-93282204 AACAAACAAAAAAATCAACCAGG + Intergenic
911148970 1:94579325-94579347 AACAAACAACAAAAGCAAAAAGG - Intergenic
911773105 1:101772633-101772655 ACCAAAGTCAATAAGCAAAGAGG - Intergenic
911819441 1:102398913-102398935 AGCAAACAAGATAAGGAATCAGG + Intergenic
911864769 1:103003968-103003990 AGCTAACAAAATAACTAAACTGG - Intronic
911945349 1:104100472-104100494 AGTAAAAAAAAAAAGCAAACAGG + Intergenic
912885517 1:113468297-113468319 ACCAAAGAAAATAACCACAAAGG - Intronic
912900202 1:113639383-113639405 AACAAACAAAAAAACTAAACAGG - Intronic
912961987 1:114204189-114204211 AATAAACAAAATAAGTAAATTGG + Intergenic
912998467 1:114555429-114555451 ACAAAACAAAACAAAAAAACTGG + Intergenic
913545288 1:119861671-119861693 TACACACAAAATGAGCAAACAGG - Intergenic
914701035 1:150133970-150133992 AACAAAACAAAGAAGCAAACAGG - Intronic
915394079 1:155568736-155568758 ACAAAACAAAACAAAAAAACTGG - Intergenic
915499097 1:156302126-156302148 AGCAAACAAAACAAACAAACTGG - Intergenic
915499586 1:156306158-156306180 ACTAAAAAAAATAAACAAAAAGG + Intergenic
916076556 1:161203321-161203343 ACAAAACAAAACAAAAAAACAGG + Intronic
916391902 1:164340549-164340571 ACAAAATATAATTAGCAAACAGG + Intergenic
916396504 1:164394627-164394649 AACAAACAAAAAAAGAAAACTGG + Intergenic
916756323 1:167773581-167773603 ACCAAACCTAAGAAGGAAACTGG - Intronic
916796095 1:168168876-168168898 AACAAACAAAAAAAGAAAACTGG - Intergenic
916839939 1:168589223-168589245 TACAAACAGAATAGGCAAACTGG + Intergenic
916887041 1:169079734-169079756 ACCAAACAAAAAACCCAAAGTGG - Intergenic
916965210 1:169932173-169932195 CCCAAACAGTATAAGCAAATTGG - Intronic
917021848 1:170597722-170597744 AACAAACAAAAAAACTAAACTGG - Intergenic
917256561 1:173122533-173122555 AACAAACAAAATGAGCAACCTGG - Intergenic
917791967 1:178504733-178504755 AACAAACAAAAAAAGAAAATGGG - Intergenic
917856821 1:179108005-179108027 AGCAGACAAAATCAGCAAAGAGG - Exonic
917986460 1:180325565-180325587 ACCAAACTAAATAAGACACCAGG - Intronic
918047557 1:180950711-180950733 CTTAAACAAAATATGCAAACAGG - Exonic
918148866 1:181781240-181781262 ACAAAACAAAATGGACAAACGGG - Intronic
918212981 1:182367905-182367927 ACCAAACAAAACAGAAAAACAGG + Intergenic
919145856 1:193633904-193633926 AACAGACAACATAAGCAAAAAGG - Intergenic
919208199 1:194445263-194445285 ACCAAAGAAAATAAATAAATTGG - Intergenic
919605092 1:199672123-199672145 ACCAAATAAAAGAAACATACTGG + Intergenic
919622367 1:199877211-199877233 AACAAACAAAAAAAGAAATCTGG - Intergenic
919729447 1:200903499-200903521 ACAAAACAAAACAAAAAAACAGG + Intronic
920722535 1:208401006-208401028 AATAAACAAAATAAGTAAGCTGG + Intergenic
920875466 1:209830520-209830542 ACAAAACAACAAAAGAAAACAGG - Intronic
921292918 1:213675508-213675530 ACCAACAAAAATAAGCAATGGGG - Intergenic
921323074 1:213962192-213962214 ACAAAACAAAACAAAAAAACTGG + Intergenic
921492015 1:215788935-215788957 ACAAAACAAAACAAAAAAACAGG + Intronic
923039071 1:230306831-230306853 ACAAAACAAAACAAAAAAACAGG + Intergenic
923255957 1:232221627-232221649 ATGAAACAAAAGAAGCAAACTGG - Intergenic
923722580 1:236479743-236479765 ATCAAAAAAAAAAAGAAAACTGG + Intronic
924366588 1:243300186-243300208 ACCAACAAAAAAAAGCAAAAGGG - Intronic
924876178 1:248106840-248106862 ACCAGACAAAACAAGCAATGGGG - Intergenic
1063185692 10:3649132-3649154 ATCAAACAAAATAATCAGAGAGG - Intergenic
1063259576 10:4370937-4370959 ACCACACAAAAGAAACAAAAAGG + Intergenic
1063573099 10:7234954-7234976 ACCAGACAAACTAAGCTGACTGG + Intronic
1063666803 10:8066546-8066568 ATCAAACAAAAATAGCAAGCTGG - Intronic
1063695404 10:8330465-8330487 AGCAAAATAAATAAGCAAAGAGG - Intergenic
1065056351 10:21846789-21846811 ACAACACAAAATAATGAAACTGG + Intronic
1065094878 10:22270652-22270674 AAAAAAAAAAAAAAGCAAACTGG + Intergenic
1065246338 10:23762312-23762334 ACAAAAAAAAAAAAGAAAACAGG + Intronic
1065406916 10:25378534-25378556 ACCAAATAACATAAGAAAAGAGG - Intronic
1065412668 10:25446696-25446718 ACCCAACACAATAAGCAAATAGG - Intronic
1065674098 10:28155780-28155802 ACAAAACAAAACAAACAAACTGG + Intronic
1065822246 10:29536406-29536428 ACTTAAAAAAATAAACAAACAGG + Intronic
1066046724 10:31601718-31601740 ACCTAAGAAAATTAGCACACTGG + Intergenic
1067260072 10:44681661-44681683 ACAAAACAAAACAAAAAAACAGG + Intergenic
1067337617 10:45377916-45377938 AACAAGCAAAATCAGCAAAGTGG + Intronic
1067637798 10:48014730-48014752 AACAAACAAAAAAAGCAAGCTGG - Intergenic
1068161274 10:53268184-53268206 ACCAATAAAAATAAGCAATTAGG + Intergenic
1068246742 10:54381589-54381611 ACAACACTAAATAAGAAAACTGG + Intronic
1068354003 10:55886885-55886907 ACAAAAACAAAAAAGCAAACAGG + Intergenic
1068519540 10:58063219-58063241 ACAAAACAAAAGAAAAAAACGGG + Intergenic
1068845589 10:61669567-61669589 AACAAACAAAAAAAGCAGTCTGG + Intronic
1069288955 10:66752722-66752744 ACAATACAAAATAAGAAAATAGG + Intronic
1069453797 10:68537880-68537902 ACAAAACAAAAAAACAAAACGGG - Intergenic
1069468858 10:68668063-68668085 AACAAACAAAAAAAGCCAAATGG - Intronic
1070072500 10:73103198-73103220 AACAACCAAAATAAGAATACTGG + Intergenic
1070253090 10:74790277-74790299 ACGAAACAAAACAAGAAAACAGG + Intergenic
1070824011 10:79380474-79380496 ACAAAACAAAACAAACACACAGG + Intergenic
1071209304 10:83318801-83318823 ACCAAATTAAATAAGCCACCAGG + Intergenic
1071218597 10:83436209-83436231 ACCAAAACAAATGAGCACACAGG - Intergenic
1071246484 10:83770654-83770676 ACCACCAAAAATAAGCAAGCAGG + Intergenic
1071414279 10:85426361-85426383 ACAAAACAAAGTCAGCAAATGGG - Intergenic
1071872862 10:89814543-89814565 AACAAACAGCAGAAGCAAACAGG - Intergenic
1072315919 10:94202919-94202941 ACCAATTAAAATAACCAACCAGG - Intronic
1072513774 10:96155575-96155597 ACCAAACAAAAAGAACAAAAAGG - Intronic
1072534208 10:96348461-96348483 AACAAACAAAACAAGCACAGAGG + Intronic
1072841758 10:98782901-98782923 AAAAAAAAAAATAAACAAACAGG - Intronic
1073049342 10:100657395-100657417 AACAAACAAAATAAACTTACGGG + Intergenic
1074037047 10:109750446-109750468 ATCACACAAAAAAAGAAAACTGG - Intergenic
1076032575 10:127172088-127172110 AACAAACAAAAAAAGAAAACAGG - Intronic
1076326904 10:129631142-129631164 AACAAAAAAAAAAAGCAGACTGG - Intronic
1076436792 10:130451986-130452008 AACAAACAAACTGAGGAAACTGG - Intergenic
1078162744 11:8855834-8855856 TCCAAACAGAATAAGGAAAGGGG + Intronic
1079019729 11:16899631-16899653 AGCAAACAAGAAAAGCAGACTGG + Intronic
1079545199 11:21625536-21625558 ACCAAAGCAAATAAGCCATCTGG - Intergenic
1079768350 11:24424430-24424452 ACAAAACAAAAGAAAAAAACTGG + Intergenic
1080259917 11:30337572-30337594 ACCAACACAAATAAGCAAAGTGG + Exonic
1080554824 11:33406548-33406570 ACAACACAACATAAGCAAAGGGG - Intergenic
1080824985 11:35840474-35840496 ACCAAACTAACTCTGCAAACAGG + Intergenic
1080953676 11:37067072-37067094 TCCAGAAAAAATAAACAAACAGG - Intergenic
1080970656 11:37271706-37271728 ACGAAACAAAATAGACAAATGGG + Intergenic
1081225567 11:40517986-40518008 ACCTGACAAAATAAGCAATGGGG + Intronic
1081371031 11:42303631-42303653 GCCAACAAAAATAAGCAAAGGGG + Intergenic
1081610781 11:44562068-44562090 ACAAAACAAAACAAAAAAACTGG - Intergenic
1081913594 11:46717110-46717132 AACAAACAAAAAAACCCAACAGG + Intergenic
1081943555 11:46966848-46966870 TCATAACAAAATATGCAAACTGG + Intronic
1082587219 11:54955787-54955809 ACCAACCAATAAAAGGAAACAGG + Intergenic
1082720096 11:56663982-56664004 AACCTACAAAAAAAGCAAACTGG - Exonic
1083277371 11:61604566-61604588 ACAAAACAAAACAAAAAAACGGG - Intergenic
1083597703 11:63926776-63926798 ACAAAACAAAAAAAAAAAACAGG - Intergenic
1084259400 11:67965452-67965474 AACAAACAAAAAAAACCAACTGG + Intergenic
1084776065 11:71376568-71376590 ACAAAACAGAGTAAGCAAATGGG + Intergenic
1085178614 11:74512269-74512291 ACCAAACAAACTAAGGCACCAGG + Intronic
1085187590 11:74589546-74589568 ATAAAACAAAATAAATAAACAGG + Intronic
1085568468 11:77537818-77537840 CAAAAACAAAATAAGCAAATGGG + Intronic
1085715879 11:78872790-78872812 ACCAAAGAAAATCAGAAGACTGG - Intronic
1085785447 11:79444282-79444304 GTCAAATAAAATAAGTAAACTGG + Intergenic
1085972533 11:81610987-81611009 AAGAAACAAAATAAGCTAAATGG + Intergenic
1086022112 11:82242775-82242797 ACAAAAAAAAAAAAGGAAACAGG - Intergenic
1086041272 11:82482334-82482356 ACCAGACAAAACAAGCAATGGGG - Intergenic
1086120826 11:83303166-83303188 CCCAGATAAAATATGCAAACAGG + Intergenic
1086982073 11:93208806-93208828 ACCAAACAGAAGAACCAACCAGG + Intergenic
1087201820 11:95353093-95353115 ACCAAACCAAATAGGAAAACAGG + Intergenic
1087601392 11:100320552-100320574 AACAAACAAAAAAACCAAATGGG - Intronic
1088625361 11:111726510-111726532 AATAAACAAGATAAGCAAATAGG - Exonic
1088631079 11:111774383-111774405 ACAAAACAAAACAAACAAAAAGG + Intergenic
1088690936 11:112326881-112326903 ACCTGACAAAATAAGCAACAGGG - Intergenic
1088841098 11:113628277-113628299 AAAAAAAAAAAAAAGCAAACAGG + Intergenic
1089210139 11:116794737-116794759 ACCAAAAAAAATAAGCAGGTTGG + Intergenic
1089433986 11:118447144-118447166 ACAAAACACAAAAAGAAAACAGG - Intronic
1089516227 11:119033507-119033529 AACAAACAAAAAAAACAGACCGG - Intergenic
1089811191 11:121133093-121133115 AGCTAAGAAAATAAGCAAACAGG - Intronic
1089912185 11:122112104-122112126 ACCAAAAAAAAAAAAAAAACAGG + Intergenic
1089964139 11:122641534-122641556 AACAAACAAAAAAAACAATCTGG + Intergenic
1090486307 11:127115449-127115471 ATGAATCAAAATAAGAAAACAGG + Intergenic
1091818601 12:3457834-3457856 AAAAAAAAAAAAAAGCAAACTGG - Intronic
1092090466 12:5799575-5799597 AACAAAGAAAATAAGGAAACAGG + Intronic
1092236323 12:6812377-6812399 AACAAACAAAAAAAGAAAGCAGG + Intronic
1092492960 12:8962757-8962779 AACAAACAAAATAAACACAAAGG + Intronic
1092866759 12:12768492-12768514 ACAAAACAAAAAAACCAACCAGG + Intronic
1093336188 12:17907097-17907119 ACCATAAAAAATAGGCAAATGGG - Intergenic
1093606691 12:21099134-21099156 AGCAAACAAAATAATCAACAGGG - Intronic
1093940865 12:25052444-25052466 AACAAAAAAAAAAAGCAAAGAGG + Intronic
1094022434 12:25928340-25928362 AACAAACAAAAAAACAAAACAGG + Intergenic
1094190739 12:27695791-27695813 AACAAACAAAAAAAGAAAATAGG + Intergenic
1094336368 12:29359938-29359960 ACCAAGCAAAATAGGCACATAGG + Intronic
1095174699 12:39078230-39078252 ACCTAAAGAAATAATCAAACTGG + Intergenic
1095542136 12:43322853-43322875 ATGAAACAAAAAAAGAAAACCGG - Intergenic
1095623825 12:44290234-44290256 AAAAATAAAAATAAGCAAACGGG - Intronic
1095682898 12:44999503-44999525 TCCAAACAAGATGAGCAAAGTGG - Intergenic
1095859098 12:46894982-46895004 AAAAAAAAAAAAAAGCAAACGGG + Intergenic
1095877744 12:47100488-47100510 AACAAACAAAATAAGTGAAAGGG - Intronic
1096004323 12:48156992-48157014 AAAAAAAAAAAAAAGCAAACTGG + Intronic
1096047152 12:48572295-48572317 AGCAATAAAAATAAGCATACAGG + Intergenic
1096406775 12:51349547-51349569 ACAAAACAAAACAAAAAAACAGG + Intergenic
1096438047 12:51612148-51612170 ACAAAACAAAAAAAACAAGCAGG - Intronic
1097083192 12:56448424-56448446 AACAACCAAAAAAAACAAACAGG + Intronic
1097426653 12:59454181-59454203 TCCAAACCAAGTAAGAAAACTGG - Intergenic
1098202547 12:68071336-68071358 ACCAAATTAAAGAAGAAAACTGG + Intergenic
1099175755 12:79419808-79419830 GACAAACAAAATGAGAAAACAGG - Intronic
1099205852 12:79725593-79725615 AACAAACAAAAACAACAAACTGG + Intergenic
1100131910 12:91504932-91504954 ACAAAAAAAAATTAGCAAGCAGG - Intergenic
1101473368 12:105020279-105020301 ACTAAAAATAATAAGCAAAATGG - Exonic
1102690692 12:114758293-114758315 ACAAAACAAAACAAAAAAACTGG - Intergenic
1103610219 12:122119379-122119401 ACAAAACAAAACAAAAAAACTGG - Intronic
1103765396 12:123275907-123275929 AACAAACAAAAAAAGAAAGCCGG + Intergenic
1104259146 12:127166662-127166684 ACCAAACAAAAAAAGATAATTGG - Intergenic
1104591826 12:130090099-130090121 ACAAAACAAAACAAAAAAACAGG + Intergenic
1104659647 12:130601347-130601369 AAAAAAAAAAAAAAGCAAACCGG + Intronic
1104675924 12:130712381-130712403 AACAAACAAAAAAATCAAATAGG - Intronic
1106001714 13:25729657-25729679 GTCAAACAAAACAAGCCAACAGG - Intronic
1106113469 13:26797375-26797397 AACAAACAAACAAAACAAACCGG + Intergenic
1106390794 13:29334011-29334033 ACAAAACAAAACAAAAAAACAGG - Intronic
1106509455 13:30400292-30400314 ATAAAACAAAATAAATAAACAGG + Intergenic
1106895760 13:34300705-34300727 CCGAAACAAAATAAACAAAAAGG + Intergenic
1106939381 13:34760653-34760675 ACCACACAAAACAACCAAAATGG + Intergenic
1107104104 13:36625364-36625386 ACAAAACAAAACAAAAAAACAGG - Intergenic
1107158747 13:37200177-37200199 ACCAACAAAAATAAGCAATGGGG - Intergenic
1107444179 13:40455729-40455751 ACAAAACAAAACAAAAAAACAGG + Intergenic
1107605617 13:42052803-42052825 ACCAAACAGTATAAACAAATGGG + Intronic
1107703855 13:43078872-43078894 ACAAAACAAAACAAAAAAACAGG + Intronic
1108414863 13:50187313-50187335 AACAAAAAAAAAAAGCAAATTGG - Intronic
1108443314 13:50478609-50478631 ACCAAAAAAAATAAACAAATAGG - Intronic
1108690287 13:52853346-52853368 ACCAAAGCAAAGAAGCAGACAGG - Intergenic
1108794908 13:54018936-54018958 AACAAACAAAAAAAAAAAACAGG - Intergenic
1108842468 13:54636589-54636611 TCCAAAGAAAAGAAGCAAACTGG - Intergenic
1108897297 13:55348276-55348298 ACAAAACAAAACAAACAAACTGG - Intergenic
1109606906 13:64707913-64707935 ACAAAACAAAAAAAACAAAAAGG - Intergenic
1109626331 13:64979607-64979629 ACCAAAAAAAAAAAAAAAACAGG - Intergenic
1109777706 13:67064010-67064032 AGCAAAGAAAAGAAGCAAAGAGG - Intronic
1109806292 13:67448499-67448521 ACCAAAAAAAAAAAGCCCACAGG - Intergenic
1109828610 13:67756025-67756047 AACAAACCAAACAAACAAACAGG - Intergenic
1110024572 13:70519331-70519353 GACAACCAAAATAAGCAAATGGG + Intergenic
1110073342 13:71207225-71207247 AACAAACAAAAAAAACAACCAGG + Intergenic
1110319822 13:74148736-74148758 ACAAAACAAAACAAAAAAACTGG - Intergenic
1110486735 13:76053512-76053534 ACCAAACACATTAAGGAAGCAGG + Intergenic
1110559146 13:76891470-76891492 AACAAACAAAAAAAAAAAACAGG + Intergenic
1111740932 13:92205177-92205199 AACAAACAAAAAAACAAAACAGG - Intronic
1112015961 13:95331659-95331681 AACAAACAGAATAACCAAAAGGG + Intergenic
1112154855 13:96806160-96806182 ACCAGGACAAATAAGCAAACAGG + Intronic
1112195156 13:97218434-97218456 ACAAAACAAAAAAAAAAAACTGG + Intergenic
1112288745 13:98126369-98126391 AAAAAAAAAAAAAAGCAAACTGG - Intergenic
1112289352 13:98131378-98131400 ACCAAACTCAATAAGAGAACAGG + Intergenic
1112375787 13:98839487-98839509 ACCAACCAAAATGATCATACAGG + Intronic
1112481698 13:99781776-99781798 AACTAAGAAAATAAACAAACTGG - Intronic
1113019759 13:105871695-105871717 ACCAAACAAAAAAACCAGCCTGG - Intergenic
1113361177 13:109632926-109632948 ACAAAACAAAACAAAAAAACAGG + Intergenic
1113696452 13:112349532-112349554 GCCAAACAAAACAAGCCAATGGG + Intergenic
1114070835 14:19104970-19104992 AAAAAACAAAATAAGTAAAAAGG + Intergenic
1114091426 14:19295036-19295058 AAAAAACAAAATAAGTAAAAAGG - Intergenic
1114316368 14:21513298-21513320 ACAAAACAAAACAAAAAAACAGG + Intergenic
1114325852 14:21588031-21588053 ACAAAACAAAACAAGCAAGCTGG + Intergenic
1114336442 14:21696022-21696044 AACAAACAAAAAAAAAAAACAGG - Intergenic
1114407212 14:22468099-22468121 TCCAAATAAAATAAGTAAAATGG + Intergenic
1114860177 14:26507896-26507918 ACAAAACAAAACAAAAAAACAGG + Intronic
1115299556 14:31868837-31868859 ACATAACAAAAAAAGAAAACTGG + Intergenic
1115615785 14:35093230-35093252 ACAAAACAAAACAAAAAAACAGG + Intronic
1115660667 14:35491404-35491426 AACAAACAAACAAAACAAACAGG - Intergenic
1115915431 14:38307424-38307446 ACTAATCAAAAGAAGAAAACAGG + Intergenic
1116026258 14:39519104-39519126 ACCAACAAAAATAAGCAATGGGG + Intergenic
1116375759 14:44198322-44198344 ATCAAACCAAAAAAGCAAAAAGG + Intergenic
1116465796 14:45231251-45231273 ACCAAACAAAAACAGAAAACTGG - Exonic
1116671727 14:47850835-47850857 ACCAGACAAAACAAGCAATGGGG + Intergenic
1116793544 14:49365395-49365417 AACCAACAAAAAAAGCAAAGAGG - Intergenic
1117109633 14:52437359-52437381 AGGATACAAAATAAACAAACTGG + Intronic
1117425423 14:55590184-55590206 ATCAAAACAAACAAGCAAACAGG - Intronic
1117566247 14:56996421-56996443 ACCAAATAATAAAAGCAAATAGG - Intergenic
1118359900 14:65046947-65046969 TACAAACAAAACAAGCAAAAAGG + Intronic
1118452059 14:65912109-65912131 AACAAACAAACAAAACAAACTGG + Intergenic
1118664034 14:68046929-68046951 ACAAAACAAAACAAAAAAACAGG - Intronic
1118673522 14:68157196-68157218 CAAAAACAAAATAAGCAAAAGGG + Intronic
1119091099 14:71782028-71782050 AACAAAGAAAATAAGCAACGGGG + Intergenic
1119648725 14:76367941-76367963 AAAAAAAAAAAAAAGCAAACTGG - Intronic
1119669996 14:76511030-76511052 ACAAAACAAAACAAAAAAACAGG - Intergenic
1119785848 14:77313677-77313699 ACAAAACAAAACAAAAAAACTGG - Intronic
1120836757 14:89045788-89045810 AACAAACAAAAAAAGCCAAACGG - Intergenic
1121221894 14:92291804-92291826 TCCAAACAAAGAAAGCATACTGG - Intergenic
1121342329 14:93112908-93112930 ACCAAACAAAACAACCTCACGGG + Intronic
1122154861 14:99744116-99744138 AAGAAACAAAATAACCAAAGAGG - Intronic
1122539218 14:102487839-102487861 ATCAAAAAAAAAAAACAAACAGG - Intronic
1122656854 14:103267890-103267912 ACCAATCCAAAAAGGCAAACTGG + Intergenic
1123675990 15:22710711-22710733 ACAAAACAAAACAAAAAAACAGG - Intergenic
1123683600 15:22781917-22781939 ACCAAAGAAAATATGCAAGGCGG + Intronic
1123908436 15:24943203-24943225 TCCAAACAAAATAAACAACCAGG + Intronic
1124261332 15:28194584-28194606 ACAAAACAAAACAAAAAAACAGG + Intronic
1124793815 15:32756152-32756174 AACAAACAAAAAAAGAAATCAGG - Intergenic
1125682242 15:41538527-41538549 AACAAAAAAAATCAACAAACAGG + Intronic
1125933010 15:43613328-43613350 ACAAAACAAAACAAAAAAACAGG - Intronic
1125946109 15:43712790-43712812 ACAAAACAAAACAAAAAAACAGG - Intergenic
1126160105 15:45603723-45603745 AACAAACAAAAAGAGCGAACTGG + Intronic
1126610175 15:50521031-50521053 AACAAACAAAAGAACCAAATTGG - Intronic
1127070617 15:55285309-55285331 ACCAAAAAAAAAAAAAAAACAGG + Intronic
1127445233 15:59055195-59055217 ACAAAACAAAAAAAATAAACAGG - Intronic
1127485156 15:59411989-59412011 AACAAACAAAAAAAAAAAACGGG + Intronic
1127962619 15:63901005-63901027 AACACTCAAAATAAGAAAACGGG + Intergenic
1128438872 15:67683839-67683861 ACCAAAAATAATTAGGAAACTGG + Intronic
1128707124 15:69844423-69844445 ACCTCACAAGATAAGCAAGCAGG + Intergenic
1129442788 15:75594015-75594037 AACAAACAAAAAAAAGAAACTGG - Intergenic
1129544252 15:76377787-76377809 CTCACACAAAATAAGCATACAGG + Intronic
1131200856 15:90394629-90394651 ACCAAACCAAAAAGGCAAACTGG - Intronic
1131593530 15:93773747-93773769 ACAAAACAAAACAAGAACACTGG + Intergenic
1131827334 15:96331855-96331877 AACAAACAAAACAAACACACCGG + Exonic
1131942282 15:97580290-97580312 ACCAAAGAAAATATACAAATGGG - Intergenic
1131944582 15:97606012-97606034 ATGAAAAAAAAAAAGCAAACTGG - Intergenic
1132043480 15:98545428-98545450 CCCAAACAAAACAACAAAACAGG - Intergenic
1132755142 16:1480732-1480754 ACAAAACAAAACAAGCACAAAGG - Intergenic
1132946381 16:2533577-2533599 ACCAAACAAACAAAAAAAACTGG - Intergenic
1133573729 16:7067514-7067536 AGAAAACAAAAAAAGAAAACAGG - Intronic
1134122584 16:11595739-11595761 ACAAAACAAAACAAAAAAACAGG + Intronic
1134153763 16:11825658-11825680 ACAAAACAAAACAAAAAAACCGG - Intergenic
1134188552 16:12103418-12103440 ACCTGACAAAATAAGCAATGGGG + Intronic
1134509820 16:14837005-14837027 ACAAAATAAAATAAGTAAAATGG - Intronic
1134697467 16:16235504-16235526 ACAAAATAAAATAAGTAAAATGG - Intronic
1134794457 16:17022251-17022273 ACAAAACAAAACAAACAAAAAGG - Intergenic
1134880441 16:17741243-17741265 TCCAAATAAAATCAGAAAACAGG - Intergenic
1134974377 16:18559171-18559193 ACAAAATAAAATAAGTAAAATGG + Intronic
1135528491 16:23232306-23232328 AACAAACAAAACAAAAAAACAGG - Intergenic
1135848532 16:25941137-25941159 ACAAAACAAAACAAAAAAACAGG - Intronic
1135894753 16:26388888-26388910 ACCAAAAAAAACAAACAATCCGG - Intergenic
1136111821 16:28068168-28068190 GCCAAACAAAATAAGCTTAAGGG - Intergenic
1136119517 16:28122613-28122635 ACAAAACAAAACAAACAAACAGG - Intronic
1136131486 16:28224754-28224776 AACAAACAAACAAAGCAACCTGG - Intergenic
1136372041 16:29842614-29842636 TCAAAACAAAAAAAACAAACCGG + Intronic
1136618379 16:31412057-31412079 AAGAAAAAAAAAAAGCAAACAGG - Intronic
1137623404 16:49891925-49891947 ACAAAACAAAACAAACAAAAAGG + Intergenic
1138929922 16:61640695-61640717 ACCAAAATAAATAAGAAAATTGG - Intergenic
1139123112 16:64043931-64043953 ACCAAACTAAATAAGCCAGCAGG + Intergenic
1139307520 16:65999763-65999785 ACAAAACAAAACAAAGAAACAGG + Intergenic
1139382141 16:66539295-66539317 ACAAAACAAGATCAGCAAAGGGG + Intronic
1140203109 16:72910800-72910822 ACAAAACAAAACAAAAAAACAGG + Intronic
1140261764 16:73386404-73386426 ATTTAAAAAAATAAGCAAACGGG - Intergenic
1140598557 16:76446245-76446267 ATCAAACAAGATGAGTAAACTGG + Intronic
1140796758 16:78445609-78445631 AACAAAACAAATAGGCAAACAGG + Intronic
1141011234 16:80401797-80401819 AACAAACAAAAAAAACAAAAGGG - Intergenic
1141400493 16:83742905-83742927 ACCAAACAAAATAAGCAAACTGG + Intronic
1141451039 16:84102529-84102551 ACCAAAAATATTAAGCACACTGG + Intronic
1142206906 16:88787616-88787638 ACAAAATAAAATTAGCAAAATGG + Intergenic
1142408553 16:89904578-89904600 AAAAAACAAAATAAACAAAGAGG + Intronic
1142774604 17:2126720-2126742 AAAAAAAAAAAAAAGCAAACTGG + Intronic
1142865361 17:2787556-2787578 ACAAAACAAAACAAAAAAACAGG - Intronic
1143155864 17:4835634-4835656 ACAAAACAAAACAAAAAAACGGG + Intronic
1143357917 17:6344385-6344407 AACAAACAAAAAAACCAAAATGG - Intergenic
1143827483 17:9622390-9622412 ACAAAACTAAATAAATAAACTGG + Intronic
1143910538 17:10245270-10245292 ACCAAATACAATAAACAAACAGG + Intergenic
1146298994 17:31673590-31673612 ACAAAACAAAAGAAAAAAACAGG + Intergenic
1146980679 17:37158636-37158658 ACAAAACAAAACAAAAAAACAGG + Intronic
1147049552 17:37781888-37781910 AATAAACATAATAATCAAACTGG + Intergenic
1147237856 17:39070980-39071002 ACAAAACAAAACAACAAAACTGG + Intronic
1147848099 17:43419561-43419583 ACAAAACAAAACAAAAAAACAGG - Intergenic
1148069771 17:44901709-44901731 ACAAAACAAAATGAAAAAACAGG - Intronic
1148283870 17:46371140-46371162 ACAAAAACAAATAAGGAAACTGG + Intergenic
1148306091 17:46589058-46589080 ACAAAAACAAATAAGGAAACTGG + Intergenic
1148874187 17:50676867-50676889 CCCAAAAAAAAAAAGCCAACAGG - Intronic
1149108928 17:53002765-53002787 ACTAAGCAAAATAACAAAACTGG + Intergenic
1149147473 17:53513296-53513318 AGAAAAAAAAATAGGCAAACTGG - Intergenic
1149335764 17:55634147-55634169 ACGATACAAAATAAGTAAACTGG - Intergenic
1150019526 17:61597024-61597046 TCTAAACAAAATAATCAAAGTGG - Intergenic
1150416619 17:64993825-64993847 ACAAAACAAAACAAAAAAACAGG + Intergenic
1150580574 17:66470182-66470204 AAAAAAAAAAAAAAGCAAACTGG - Intronic
1150809142 17:68343136-68343158 ACAAAACAAAAAAAGGAAATAGG - Intronic
1150885056 17:69075508-69075530 AACAGACAAAATAAGCAATCGGG - Intergenic
1150911430 17:69391507-69391529 GTAAAACAAAATAAGCAAAATGG + Intergenic
1150971775 17:70036203-70036225 ACAAAACTAAATAAGCCAAATGG + Intergenic
1151634210 17:75333374-75333396 ACCAAACCAAACAAAAAAACTGG - Intronic
1152090314 17:78242950-78242972 AACAAACAAAAAAAGTAACCAGG - Intergenic
1153446306 18:5176451-5176473 AACAAACAAAAAAAACAAACTGG + Intronic
1154015527 18:10613107-10613129 ACAAAACAAAAAAACAAAACAGG + Intergenic
1154189982 18:12222529-12222551 ACAAAACAAAAAAACAAAACAGG - Intergenic
1155286265 18:24292593-24292615 ACCAAAGATAATCGGCAAACAGG + Intronic
1155436466 18:25817827-25817849 ACCAAAAAAAAAAATAAAACTGG + Intergenic
1155441016 18:25862799-25862821 TGGAAACAAAATAAGCAAAGAGG + Intergenic
1155485867 18:26341906-26341928 AATAAACAAAACAAACAAACAGG - Intronic
1155546442 18:26920796-26920818 AACAAATAAAATAAGCACATGGG + Intronic
1155733736 18:29195144-29195166 TCAAAACAAAAAAAGCAAAGGGG + Intergenic
1155961326 18:31997839-31997861 ACAAAACAAAACAAAAAAACTGG - Intergenic
1156751173 18:40457560-40457582 ACAAAACAAAATAAGCTATGAGG + Intergenic
1156751229 18:40458187-40458209 ACAAAACAAAATAAGCTATAAGG + Intergenic
1156810617 18:41245409-41245431 AACAAACCACATAGGCAAACAGG - Intergenic
1157817443 18:50740262-50740284 AACAAACAAAAAAAAAAAACTGG + Intergenic
1158178355 18:54683536-54683558 ACCAAAATAAATAAGAAGACTGG + Intergenic
1158205128 18:54984574-54984596 ACCAAACAAAATTCGCAATTTGG + Intergenic
1159498982 18:69243787-69243809 ATCAAACAACAAAAGCAAACTGG - Intergenic
1159673342 18:71250867-71250889 AACAAACAAAAAAAGAAAAAGGG + Intergenic
1159812946 18:73038781-73038803 ATCAAAAAAAATAATCCAACAGG - Intergenic
1161915210 19:7223190-7223212 AACAAACAAAAAAAACCAACTGG + Intronic
1162708826 19:12576517-12576539 AACAAACAAAATAACCAGCCAGG + Intronic
1163010968 19:14425879-14425901 AACATGCAAAATAATCAAACAGG + Intergenic
1163116795 19:15193781-15193803 AAAAAACAAAAAAAACAAACAGG + Intronic
1163140361 19:15343849-15343871 AGCAAAACAAATAAACAAACTGG - Intergenic
1163563883 19:18038146-18038168 ACCAAAAAAAATAAATAAAAAGG - Intergenic
1163924932 19:20331445-20331467 ACAAAACAAAACAAAAAAACAGG + Intergenic
1164275726 19:23716194-23716216 AAAAAAAAAAAAAAGCAAACAGG - Intergenic
1164443420 19:28297636-28297658 AATAAACAAAACAAACAAACTGG + Intergenic
1165558423 19:36656718-36656740 AACAAACAAAGCAAACAAACAGG + Intronic
1165786384 19:38464299-38464321 AAAAAAAAAAAGAAGCAAACGGG + Intronic
1165905010 19:39188421-39188443 ACAAAACAAAACAAAAAAACTGG - Intergenic
1166027069 19:40096436-40096458 ACAAAACAAAACAAGCTAAAAGG + Intergenic
1166117180 19:40663233-40663255 ACAAAACAAAATCACCCAACAGG + Intergenic
1166236041 19:41457647-41457669 TGCAAACAAAATAAGAAAAAAGG - Intergenic
1166577101 19:43852267-43852289 ATCAAACAAAATAACCTAATAGG - Intergenic
1167132938 19:47599576-47599598 AAAAAAAAAAAAAAGCAAACTGG - Intergenic
1167550423 19:50156513-50156535 ACCAGCCAAAGGAAGCAAACAGG + Intronic
1167805247 19:51778642-51778664 ACAAAACAAAAAAAGAAAACAGG - Intronic
1167934108 19:52892384-52892406 AACAAACAAAAAAAGAAAATAGG + Intronic
1168144370 19:54412137-54412159 ACTCAAAAAAATAAACAAACAGG - Intergenic
1168651022 19:58092271-58092293 ACAAAACAAAACAAAAAAACAGG + Intronic
925243612 2:2358521-2358543 AGCCAACAAAAGCAGCAAACAGG - Intergenic
925547614 2:5035238-5035260 ACAAAACAAAATGGGCACACCGG + Intergenic
926921392 2:17944002-17944024 AACAAACAAAAAAACCAAAAAGG + Intronic
927771247 2:25863703-25863725 ACAAAACAAAACAAAAAAACAGG + Intronic
927984435 2:27398462-27398484 AACAAACAAAATAGACAAATTGG + Intronic
928693171 2:33821601-33821623 ACAACAACAAATAAGCAAACTGG + Intergenic
929156061 2:38789571-38789593 ACAAAACAAAATAACAAAACAGG + Intergenic
929697895 2:44134889-44134911 ACAAAACAAAACAAACAGACAGG + Intergenic
929715003 2:44301291-44301313 AGTCAGCAAAATAAGCAAACAGG - Intronic
929781434 2:44959764-44959786 ACAAAACAAAACAAAAAAACAGG + Intergenic
930124578 2:47785215-47785237 ACCAAACAAAAAACACGAACTGG - Intronic
930278212 2:49338732-49338754 ACCAAACAAAGAAACTAAACTGG - Intergenic
930393178 2:50787257-50787279 ACAAAACAAAACAAGAAAACAGG + Intronic
930397873 2:50846194-50846216 ACAAAACAAAATGAACAACCTGG - Intronic
930778419 2:55197844-55197866 AACAAACTAAATAAGGTAACAGG + Intronic
930793436 2:55359516-55359538 AACAAACAAAATAATCTGACGGG + Intronic
930878168 2:56243634-56243656 AACAAACTAAATAAGGAACCAGG - Intronic
931303949 2:61009623-61009645 ACAAGACAAATTAGGCAAACTGG - Intronic
931304911 2:61018464-61018486 ACCAAACAAAAAAAAAATACAGG - Intronic
933019649 2:77174633-77174655 AACAAACAAAAAAAACAACCAGG - Intronic
933227314 2:79765999-79766021 ACCAATCAAAACAAGAAAGCTGG - Intronic
933815395 2:86064079-86064101 ACCAAATAAAATTAGGAAATAGG + Intronic
933871369 2:86568621-86568643 ATCAAAAAAATTATGCAAACAGG - Intronic
933917151 2:87007135-87007157 AGCAAACAAAAAAACTAAACAGG - Intronic
934005845 2:87762779-87762801 AGCAAACAAAAAAACTAAACAGG + Intronic
935043702 2:99459716-99459738 AACAAACAAAACAAACAAAAAGG + Intronic
935565746 2:104605302-104605324 ACAAAACAAAACAAAAAAACTGG + Intergenic
935565851 2:104606624-104606646 ACATAACAAAATAGGCAGACTGG + Intergenic
935911302 2:107899046-107899068 AGCAAACAAAAAAACTAAACAGG - Intergenic
936588072 2:113776242-113776264 AACAAACAAAAAAAAAAAACTGG - Intergenic
937348707 2:121145000-121145022 ACAAAACAAAACAAAAAAACTGG - Intergenic
937384280 2:121413281-121413303 AACAAACAAAAAAAGCAAAGGGG + Intronic
937384788 2:121419165-121419187 AACAAACAGAATAACCACACTGG + Intronic
937524306 2:122748336-122748358 ATCAAAAAAGATAAGCAAAAGGG + Intergenic
938106225 2:128531906-128531928 ACCAAACAAACAAAGAAAATGGG + Intergenic
938141929 2:128801451-128801473 ACAAAACAAAATAAGCATGGTGG - Intergenic
938231034 2:129659255-129659277 ACAAAACAGAAAAAGCAAACAGG - Intergenic
938460600 2:131493679-131493701 ACGAAACAAAAAAAACAAACGGG + Intergenic
939537794 2:143454053-143454075 AACAAACAAAAGAAACAAATTGG + Intronic
940234546 2:151495679-151495701 AACAAACAAAAAACGAAAACTGG + Intronic
941249362 2:163143726-163143748 AGAAAAAAAAAAAAGCAAACAGG - Intergenic
941672427 2:168309639-168309661 AACAAACTAAATAAGCCACCAGG - Intergenic
941834894 2:170005226-170005248 ACAAAACAAAACAAAAAAACCGG + Intronic
942106597 2:172639810-172639832 AACAAACAAAATCAGCAAAATGG + Intergenic
942198417 2:173546202-173546224 AGAGACCAAAATAAGCAAACAGG - Intergenic
942501471 2:176595206-176595228 GCAAAGCAAAATAAGCAAAGGGG + Intergenic
943486517 2:188491373-188491395 ATAAAAGAAAATTAGCAAACAGG + Intronic
944162883 2:196685076-196685098 ACGAAACAAAAAAAGCAAAATGG - Intronic
944194700 2:197040252-197040274 ACAAAACAAAACAAAAAAACAGG + Intronic
944258701 2:197652786-197652808 CCCAAACAAAAAAATCTAACAGG + Intronic
944354706 2:198773401-198773423 ACCAAACAAAACAAAAAAACAGG - Intergenic
945322991 2:208448255-208448277 AACAAACAAAATAACCTAAAGGG - Intronic
945578755 2:211565815-211565837 ACCAAACAAAAGAAGTAAGCTGG + Intronic
945822337 2:214680106-214680128 GAAAACCAAAATAAGCAAACAGG + Intergenic
945830898 2:214783745-214783767 ACCTAACAAAACAAGCAATGGGG + Intronic
946205317 2:218102411-218102433 AACAAGCATAATAAGCAAAAAGG - Intergenic
946580348 2:221121551-221121573 AACAAACAAAATATGGCAACTGG - Intergenic
947120813 2:226812764-226812786 ACAAAACAAAACAAGCAATATGG - Intergenic
947453128 2:230226433-230226455 ACCCAACAAAAAAGGCAAGCAGG + Intronic
947558492 2:231121631-231121653 AACAAACAAAATACAAAAACAGG - Intronic
947573824 2:231256811-231256833 AACAAACAAAAAAACCACACAGG - Intronic
947631024 2:231653068-231653090 AACAAACCAAATACACAAACAGG - Intergenic
947688204 2:232109603-232109625 ACCTGACAAAATAAGCAAGGGGG + Intronic
947844568 2:233233425-233233447 ACAAAACAAAAAAAACACACCGG - Intronic
947863237 2:233377796-233377818 AACAAACAAAAAAACCAAAGAGG - Intronic
947899009 2:233704632-233704654 ACCAAAAATGATAAGCAAAAAGG - Intronic
948579674 2:238976989-238977011 ACCAAAAAAAATAGACAAATTGG + Intergenic
1168822277 20:782896-782918 ACGAAACAAAACAAAAAAACAGG + Intergenic
1169097499 20:2916025-2916047 ACAAAACAAAAAAATCAAAGTGG - Intronic
1169234589 20:3920544-3920566 AACAAACAAAAACACCAAACAGG + Intronic
1170354392 20:15476511-15476533 ACAAAACAAAACAAACATACAGG + Intronic
1170455358 20:16527816-16527838 TCCTAACCAAATAAACAAACAGG + Intronic
1170561215 20:17560148-17560170 CCCAAAGAAAATAAAAAAACAGG + Intronic
1171142533 20:22755434-22755456 ACCACACAACATATGCACACAGG - Intergenic
1172024526 20:31938895-31938917 AACAAACAAAAAAAACAAATAGG + Intronic
1172257127 20:33529008-33529030 AACAAAAAAAACAAACAAACTGG - Intronic
1172322660 20:34008623-34008645 GCCAAACAAAATATGTACACAGG - Intronic
1172352472 20:34254044-34254066 ACAAAACAAAACAAAAAAACAGG - Intronic
1172421168 20:34819433-34819455 ACCAAACAAAATACTTATACAGG + Exonic
1172672256 20:36642567-36642589 ACAAAACAAAATTTGCAAAGAGG - Intronic
1173084110 20:39898737-39898759 ACAAAACAAAAAAAAAAAACAGG + Intergenic
1173127035 20:40346608-40346630 AACAAACCAAATAAGACAACAGG + Intergenic
1173492077 20:43491118-43491140 ACCAAACCAAACAACTAAACTGG + Intergenic
1173789404 20:45817901-45817923 ACCAAAATAAATAAACAGACTGG - Intergenic
1173931357 20:46822778-46822800 AACAACCAAAATAAATAAACTGG - Intergenic
1174031964 20:47636060-47636082 ACCAAGTAAAGTAAGCAATCAGG + Exonic
1174344249 20:49918060-49918082 ACAAAACAAAAAAAGTCAACTGG + Intergenic
1174613015 20:51814583-51814605 ACAAAACAAAACAAAAAAACCGG - Intergenic
1174645287 20:52080206-52080228 ACAAAAGAAAAAAAGCAAGCAGG + Intronic
1174652517 20:52139665-52139687 ACAAAACAAAATAAAGAAAATGG + Intronic
1175335130 20:58190845-58190867 ACAAAGCAAAATAAACAAAAAGG - Intergenic
1175720679 20:61285069-61285091 AACAAACAAAAAAAAAAAACAGG - Intronic
1176290120 21:5039325-5039347 AACAAACAAAATAAACAGGCCGG + Intronic
1177326733 21:19600441-19600463 ACAAAACAAAAGAAAAAAACAGG - Intergenic
1177456530 21:21346206-21346228 ACCAAAAAAAAAAAAAAAACAGG + Intronic
1177550932 21:22621402-22621424 ACAAAACAAAACAAAAAAACAGG + Intergenic
1178443425 21:32617152-32617174 AACAAACAAAAAAACCAGACAGG + Intergenic
1178785240 21:35647629-35647651 ACAAAAAAAAAAAAGAAAACAGG - Intronic
1179246858 21:39640739-39640761 AACAAACAAAAAAAGCATCCAGG - Intronic
1179564266 21:42236627-42236649 ACAAAATCAAATAAGCAAGCAGG - Intronic
1179578898 21:42325813-42325835 AACATACAAAATAAATAAACAGG + Intergenic
1179817317 21:43915358-43915380 AATATACAAAATAAGAAAACAGG - Intronic
1179867135 21:44224316-44224338 AACAAACAAAATAAACAGGCCGG - Intronic
1180489300 22:15827435-15827457 AAAAAACAAAATAAGTAAAAAGG + Intergenic
1181274434 22:21679606-21679628 ACAAAACAAAACAAAAAAACGGG + Intronic
1181525616 22:23483922-23483944 ACAAAACAAAACAAAAAAACCGG + Intergenic
1182282052 22:29223554-29223576 ACCAACCAAAAAAAGAAATCTGG + Intronic
1182560539 22:31155769-31155791 ACCCAACAAAAAGAGCAAAGAGG + Intergenic
1183500167 22:38174094-38174116 ACCAAAAAACAAAAACAAACGGG + Intronic
1183849408 22:40571761-40571783 ACCAAAAAAAAAAAGCAGCCGGG + Intronic
1183990916 22:41596588-41596610 ACAAAACAAAACAAAAAAACAGG - Intergenic
1184749552 22:46477483-46477505 ACAAAACAAAACAAAAAAACAGG - Intronic
1185105010 22:48863623-48863645 ATAAAACAAAATAAGAACACAGG + Intergenic
1185354398 22:50358256-50358278 ACAAAACAAAATAAACAAACAGG - Intronic
949512820 3:4781685-4781707 AACAAAATAAATAAGGAAACAGG + Intronic
949568905 3:5272717-5272739 AACAAACAAAATAATCAAATCGG + Intergenic
949584467 3:5424324-5424346 ACGAAACAAAAATAGCAAACAGG - Intergenic
949734016 3:7149612-7149634 ACAAAAATAAATAAGCACACTGG + Intronic
951724012 3:25735377-25735399 ATTAAAAAAAATAAGCAAAGGGG + Intronic
951874920 3:27413076-27413098 ACAAAACAAAAAAAGGAAAGAGG + Intronic
952724259 3:36566623-36566645 AACAAACAAAATAAGCATGATGG - Intergenic
953050671 3:39339815-39339837 ACAAAACAAAACAAAAAAACAGG + Intergenic
954668521 3:52274591-52274613 ACAAAACAAAACAAAAAAACAGG + Intronic
955003726 3:54950585-54950607 ATCAAAGAAAATATGCCAACAGG + Intronic
955140856 3:56267783-56267805 ACAAAACAAAACAAAAAAACAGG + Intronic
955203484 3:56874243-56874265 AACAAACAAAAAATGCCAACAGG + Intronic
955274207 3:57532339-57532361 ACCAAACTAAATAAGGCACCAGG - Intronic
955726779 3:61941621-61941643 ACAAAACAAAACAAAAAAACAGG + Intronic
956830950 3:73047864-73047886 ACAAAACAAAACAAAAAAACCGG - Intronic
956937877 3:74124520-74124542 AAGAAAGAAAATGAGCAAACTGG + Intergenic
957074961 3:75594834-75594856 AACAAACAAAAAAACCAGACAGG - Intergenic
957164407 3:76653063-76653085 ACAAAACAAAAAAAGCAAAATGG - Intronic
957201937 3:77146979-77147001 ACAAAACAAAACAAGAAAAATGG + Intronic
957462662 3:80541783-80541805 AACAAACAAATAAAGCAAAGAGG + Intergenic
957575637 3:82004072-82004094 ATCAAATAAAATAAACATACTGG + Intergenic
957739861 3:84250450-84250472 ACCTAACAAAATAAGCAATAGGG - Intergenic
957988656 3:87603388-87603410 AATAAACAAAACAAACAAACTGG + Intergenic
958017928 3:87964332-87964354 ACCAATAAAAATAAGCAACATGG + Intergenic
958056385 3:88417661-88417683 ATAAAACAAAATGAGCAATCAGG - Intergenic
958090285 3:88868948-88868970 AACAAACAAGATAAGCATATTGG + Intergenic
958137537 3:89515282-89515304 ACAAAACAAAACAAAAAAACCGG - Intergenic
958593999 3:96199099-96199121 AACAAACAAATTAAATAAACTGG + Intergenic
958668919 3:97177905-97177927 TCCAAACAAAAGATGCAGACTGG - Intronic
958707262 3:97671460-97671482 ACCAAACAAAAGACCCAACCAGG - Intronic
959018557 3:101163546-101163568 ATCAAAACAAATAAGAAAACAGG + Intergenic
959829597 3:110844569-110844591 ACCTAACAAAAAAAGCAATGGGG + Intergenic
960122735 3:113963761-113963783 AACAAACAAAATAATAAAATTGG + Intronic
960878111 3:122316671-122316693 AACAAACAAAAAAAGTAAGCCGG - Intergenic
961001617 3:123377991-123378013 AACAAACAAAACAATCAAACTGG + Intronic
961039753 3:123669352-123669374 ACCAAACAATGTAAGAAATCAGG + Intronic
961583859 3:127905884-127905906 ACCTGACAAAATAAGCAATGGGG + Intergenic
961799791 3:129438771-129438793 ACAAAAAAAAACAAGCAACCGGG + Intronic
961927363 3:130495360-130495382 AACCAACAGAATAAGCAAACTGG - Intergenic
962172316 3:133114687-133114709 ACCAAAGAAATAAAGCCAACTGG - Intronic
962242841 3:133765806-133765828 ACCAAAATAAATATGCAAAATGG - Intronic
963268061 3:143258759-143258781 TCCAAACAAAATGAACAACCAGG + Intergenic
963301921 3:143607711-143607733 TCCAAACAAAATCAGGAAAGAGG + Intronic
964045839 3:152325266-152325288 TCCAAACTACATAAGCAAAGAGG - Intronic
964102497 3:153004330-153004352 AACAAACAAAAAAAGGAAACAGG - Intergenic
964463052 3:156958146-156958168 ACAAAACAAAAAAACCAACCTGG - Intronic
964510232 3:157442049-157442071 AACAAAGAAAATATGCAAATTGG + Intronic
964711135 3:159673040-159673062 AAGAAACAAAAGAAGTAAACAGG - Intronic
965149560 3:164952309-164952331 ACAAAACAAAAAAAAAAAACTGG + Intergenic
965991762 3:174827642-174827664 ATATAACATAATAAGCAAACAGG + Intronic
966236914 3:177711991-177712013 GACAAAGAAAATAAGAAAACAGG - Intergenic
966249138 3:177842703-177842725 ACTGAAAAAAATAAGAAAACAGG - Intergenic
966649622 3:182284991-182285013 ACCAAACCAGAAAAACAAACAGG - Intergenic
967502234 3:190211984-190212006 ACCAAAAAAAAAAATCAAAATGG + Intergenic
967961312 3:194926993-194927015 AACCAACAAAAAAAGAAAACAGG + Intergenic
968333758 3:197895163-197895185 AACAAACAAAAAAAACAAAGAGG + Intronic
968880352 4:3295356-3295378 ACCAAGCAAAATAATCAGGCTGG + Intronic
969027536 4:4185694-4185716 GCCAACCAAAATGAGGAAACCGG + Intergenic
969735428 4:8986246-8986268 AACAAACAAAAAAAACAAAGAGG + Intergenic
970339335 4:15087889-15087911 ACAAAACAAAACAAAAAAACAGG - Intergenic
970357078 4:15265774-15265796 AACAAACAAAATCAGTAAAATGG + Intergenic
970760699 4:19483090-19483112 ATCATAAAAAATTAGCAAACTGG + Intergenic
970841087 4:20470561-20470583 ACAAAACAAAAAAAACAAACTGG - Intronic
970866382 4:20763571-20763593 CCCAAACAAAATAAGAAGTCTGG + Intronic
970921315 4:21398724-21398746 CCCAAACACAAAAAGCACACTGG + Intronic
971313262 4:25545294-25545316 ACAAAACAAAACAAAAAAACTGG - Intergenic
971463614 4:26929833-26929855 ACTAAACAAAATAAGTAAGCAGG + Intronic
971530622 4:27684072-27684094 ACAAAACAAAACAAAAAAACAGG + Intergenic
971882745 4:32400637-32400659 ACAAAACAAAACAAAAAAACAGG + Intergenic
972202968 4:36737457-36737479 ACAAAACAAAACAAAAAAACTGG + Intergenic
972402185 4:38715897-38715919 ACAAAACAAAACAAAAAAACAGG - Intergenic
972483527 4:39520763-39520785 AACAGACAAAATTAGGAAACAGG + Intronic
972576346 4:40355744-40355766 AACAAACAAAACAAAAAAACAGG - Intergenic
972662800 4:41132581-41132603 AGCAAACAAACTAAGCATAAAGG + Intronic
972784796 4:42316373-42316395 AACAAACAAAAAAAGCAAAAAGG + Intergenic
973686534 4:53376283-53376305 ACAAAACAAAACAAAAAAACAGG + Intergenic
973735921 4:53871725-53871747 ATCAAAGGAAATCAGCAAACAGG + Intronic
974510130 4:62828884-62828906 ACCAAAGAAAATATGCAGATTGG - Intergenic
974634591 4:64544430-64544452 ATAAAACACAATAAGCAAGCGGG - Intergenic
974698528 4:65406861-65406883 ATCAAACAAAAAAATCAAACTGG + Intronic
974992115 4:69105973-69105995 ATAAAACAAAATAAGCACGCAGG + Intronic
975083804 4:70312223-70312245 ATAAAACAAAATAAGCATTCTGG + Intergenic
975520468 4:75295472-75295494 AAAAAACAAAAAAAACAAACAGG - Intergenic
975919520 4:79368237-79368259 ACCAAACAAGAAAAAAAAACTGG + Intergenic
976211191 4:82671886-82671908 AACAAACAAAAAAAGACAACTGG + Intronic
976634204 4:87271387-87271409 TCAAAGAAAAATAAGCAAACGGG - Intergenic
977000371 4:91490965-91490987 ATTAAAAAAAATAAGCAAAAAGG + Intronic
977011754 4:91644027-91644049 AGCAAACAAAAACATCAAACTGG - Intergenic
977517545 4:98040331-98040353 ACCAAAACAAATAGGCAAATGGG - Intronic
977563969 4:98562685-98562707 ACAAAACAAAACAAAAAAACAGG + Intronic
977961032 4:103085778-103085800 ACAAAACAAAACAATAAAACAGG + Intronic
978760092 4:112348041-112348063 ACCAAAGAAAGTAAGCAGAGTGG + Intronic
978774937 4:112496356-112496378 TCCAAACAAAATAAATAAATAGG - Intergenic
978874033 4:113616908-113616930 AGAAAACAAAATAAGCAGAATGG - Intronic
979059077 4:116032105-116032127 GAAAAAAAAAATAAGCAAACTGG + Intergenic
979342600 4:119544224-119544246 AACAAACAAAAAGAGCAAAAAGG - Intronic
980034428 4:127867254-127867276 ACAAAACAAAACAAAAAAACAGG + Intergenic
980247757 4:130269418-130269440 TCCAAACAAAATATGAAAAGAGG - Intergenic
980561655 4:134485110-134485132 ACAAAACAAAACAAAAAAACAGG - Intergenic
980949991 4:139365696-139365718 ACCAAACAAAATAGGCATGGTGG + Intronic
980954770 4:139417141-139417163 ACAAAACAAAAAAAACAAAAAGG - Intronic
981027469 4:140091542-140091564 ACAAAACAAAAAAAAAAAACAGG + Intronic
981231323 4:142359219-142359241 AACAAACAAAAAAAAAAAACAGG + Intronic
981620095 4:146686296-146686318 CCCAAACAAAATAAGTGTACAGG - Intergenic
983093797 4:163538770-163538792 ACCAAAGAAAATAACAGAACAGG - Intronic
983179212 4:164628258-164628280 AACAAAAAAAATAAACAAATAGG + Intergenic
983205765 4:164908933-164908955 ATAAAATAAAAAAAGCAAACTGG + Intergenic
983208490 4:164934851-164934873 ACAAAACAAAACAAAAAAACTGG - Intergenic
983571097 4:169208979-169209001 ACCAAACAAAATAAAAAATGAGG + Intronic
983902511 4:173151107-173151129 ACACAACAAAATAAGCAACTAGG - Intergenic
983902756 4:173153825-173153847 AAAAAAAAAAAAAAGCAAACTGG + Intergenic
984109252 4:175591082-175591104 ACCAAAAAAAAAAATCAAATTGG + Intergenic
984140492 4:175999751-175999773 ACAAAACAAAACAAAAAAACTGG + Intronic
984343785 4:178493265-178493287 ACAAAACAAAATTAACAAAATGG + Intergenic
984945843 4:184968111-184968133 AACAAACAAAAGAAGGAAAGAGG + Intergenic
987098702 5:14573604-14573626 ACTACAAAAAATAAACAAACAGG + Intergenic
987128563 5:14838687-14838709 GCCAAACAAAATAATCCAGCTGG - Intronic
987685941 5:21201204-21201226 ACCAAACAAAATAAGCCCCCAGG - Intergenic
987687003 5:21217942-21217964 CCCATACAAAATAAGACAACTGG - Intergenic
988125066 5:27021655-27021677 ACCACACATAATTAGCATACAGG - Intronic
988211553 5:28210947-28210969 AACAAACAAAAAAAAAAAACTGG + Intergenic
988433991 5:31151937-31151959 AACAAACACAATAATCACACAGG - Intergenic
988736560 5:34027742-34027764 AAAAAAAAAAAAAAGCAAACTGG + Intronic
988946301 5:36204391-36204413 ACCATAAAAAATAGGCAAAGTGG - Intronic
989218090 5:38925920-38925942 TCCCAACCAAATATGCAAACAGG - Intronic
989372120 5:40721691-40721713 ACAAAACAAAACAAAAAAACAGG + Intronic
989472185 5:41832657-41832679 ACCAAACAAAATAAGGCACCGGG + Intronic
991021171 5:61981674-61981696 ACCAAACAAAAGAAGGGAAAAGG + Intergenic
991035997 5:62128071-62128093 AGCAAACACAATTAGCAAAATGG - Intergenic
991307720 5:65198048-65198070 AGGAAACAAAAGAAGCAGACAGG + Intronic
991676657 5:69094827-69094849 ACAAAATAAAAAAAGAAAACGGG - Intronic
991932666 5:71769299-71769321 GCCAACCAAGAGAAGCAAACTGG + Intergenic
992100873 5:73406271-73406293 ACAAAACAAAACAAAAAAACAGG + Intergenic
992354146 5:75963264-75963286 ACCAAATAAAAGAAGCATACAGG - Intergenic
992562722 5:77968210-77968232 ACAAAACAAAAACAGCAAATAGG + Intergenic
992770930 5:80047367-80047389 ACCAAACAAAACAAAAAAACGGG - Intronic
993635280 5:90335458-90335480 AGAAAATAAAAAAAGCAAACAGG - Intergenic
993703529 5:91144650-91144672 AGCCAACAAAATAATCAAAATGG + Intronic
994018613 5:94998186-94998208 ATTTAAAAAAATAAGCAAACAGG + Intronic
994105429 5:95943057-95943079 AAGAAACAAAAGAAACAAACAGG + Intronic
994777769 5:104056780-104056802 ACTAAGCAAAAAAAGCAAATTGG - Intergenic
995100016 5:108289150-108289172 ACAAAACAACATAATCATACAGG - Intronic
995171197 5:109114689-109114711 ACCAAAAAAATAAAGCAGACTGG + Intronic
995273547 5:110251059-110251081 ATCAAACAAAATGAGAAAATGGG - Intergenic
995381233 5:111535834-111535856 ACAAAACAAAGCAAACAAACAGG - Intergenic
996216608 5:120874971-120874993 ACCAAACAATATTGGCAAATGGG - Intergenic
996742800 5:126817067-126817089 AACAAACAAACCAAACAAACGGG - Intronic
996940270 5:128996317-128996339 AGAAAACAAAATAAGGAAAGGGG - Intronic
997784277 5:136693704-136693726 TATACACAAAATAAGCAAACAGG - Intergenic
998538497 5:142956580-142956602 ACAAAACAAAATAAAAAAGCAGG + Intronic
998676721 5:144417402-144417424 TCCAAAGAAAATATGCAAATGGG - Intronic
998688239 5:144555070-144555092 ATCAACAAAAATAAGCAAAAGGG - Intergenic
998720381 5:144939781-144939803 GCAAAACAAAATAAACAAATGGG + Intergenic
999095007 5:148969975-148969997 GACAAACAAAAAAAGCAAAAAGG - Intronic
1001507612 5:172292361-172292383 AGGAAACAAAAGAAGGAAACAGG - Intergenic
1001609779 5:172990943-172990965 ACAAAACAAAACAAAAAAACAGG - Intronic
1001789925 5:174447312-174447334 ACCAAATAATTTAATCAAACTGG - Intergenic
1002051259 5:176572909-176572931 ATGAAACAAAATAAGCAGAATGG + Intronic
1002694576 5:181076226-181076248 AACAAACAAAACAAACAAATAGG + Intergenic
1002713575 5:181210266-181210288 AAAAAACAAAATAAACAAAAAGG - Intergenic
1003352293 6:5329406-5329428 ACAAAACAAAACAAAAAAACAGG - Intronic
1003729133 6:8801234-8801256 ACAAAACAAAACAACAAAACTGG - Intergenic
1003769079 6:9277228-9277250 ACCATACAAAAAAATCAAAATGG - Intergenic
1004845231 6:19634462-19634484 ATCAAACGAAAAAATCAAACAGG - Intergenic
1004989694 6:21123459-21123481 ACAAAACAAAACAAAAAAACAGG + Intronic
1005751122 6:28883938-28883960 TCCAAACAAAATATGTAAATAGG - Intergenic
1005920777 6:30398737-30398759 CCCAAACAAAATAGACAAATGGG - Intergenic
1005973258 6:30778032-30778054 ACAAAACAAAACAAAAAAACAGG + Intergenic
1006327124 6:33362780-33362802 ACAAAACAAAACAAAAAAACTGG + Intergenic
1006390988 6:33758363-33758385 AACAAACAAAACAAAAAAACTGG + Intergenic
1006562955 6:34929572-34929594 ACCAAAAAATCTAAGCAAAGTGG - Intronic
1006980986 6:38147918-38147940 AGCAAAGGAAATAATCAAACAGG - Intronic
1007533806 6:42566378-42566400 AACAAACAAAAAAAGTAAACAGG - Intronic
1007542502 6:42660959-42660981 AACAAACAAAAAAACCACACAGG - Intronic
1008340516 6:50358216-50358238 ACAAAACAAAACAAAAAAACAGG + Intergenic
1008641881 6:53473002-53473024 AACAAACAAAATAAGGCACCAGG - Intergenic
1009683897 6:66931405-66931427 GCCAGATAAAATAAGCATACTGG - Intergenic
1009886467 6:69629455-69629477 ATAAAAAAAAATAAGTAAACTGG + Intergenic
1009912589 6:69950594-69950616 GTCAATCAAAATAAGTAAACTGG + Intronic
1010114750 6:72290393-72290415 ACAAAACAAAACAAACAGACAGG + Intronic
1010130402 6:72486140-72486162 ACAAAACAAAACAAAAAAACAGG - Intergenic
1010343368 6:74782579-74782601 AACAAACTAAATAAGGCAACAGG + Intergenic
1010418242 6:75640478-75640500 AATATACAAAATAAACAAACAGG - Intronic
1010715061 6:79219146-79219168 AACAAACAAAATAATACAACAGG + Intronic
1010858231 6:80870614-80870636 ACCAAACAAAAGCATAAAACGGG + Intergenic
1011059479 6:83248152-83248174 ATCAAACAAAACAAGCAATTAGG - Intronic
1011528459 6:88293101-88293123 AACAAATAAAATAATAAAACAGG + Intergenic
1011570735 6:88731587-88731609 ACAATAAAAAATAAACAAACTGG + Intronic
1011756813 6:90508597-90508619 AACAGACAAAATAAGGAACCAGG - Intergenic
1012145903 6:95681189-95681211 ACCAAAAAAAATAATAAAAAAGG + Intergenic
1012613955 6:101252368-101252390 ACAAAACAAAACAAAAAAACTGG - Intergenic
1012635918 6:101541445-101541467 ACCCAACCAAACAAACAAACTGG + Intronic
1012789032 6:103668851-103668873 GCTAAAAAAAATAGGCAAACTGG - Intergenic
1012877959 6:104751949-104751971 ACCAAACAAAAAAAAAAAACAGG + Intronic
1012952079 6:105529087-105529109 ATCAAAGAAAATCAGCCAACTGG + Intergenic
1013331697 6:109108515-109108537 GTCAAACAAAATAAGAAAAATGG - Intronic
1013531432 6:111022887-111022909 AACAAACAAAAAAAGAAATCAGG - Intronic
1013574887 6:111472817-111472839 ACCAAACAAAAACACCAAAAAGG + Intronic
1013628759 6:111964254-111964276 ACTAAAAAAAAAAATCAAACTGG - Intergenic
1013723913 6:113068363-113068385 ACAAAAAAAGAAAAGCAAACTGG + Intergenic
1014186811 6:118444554-118444576 AACAAACTAAATAAGCCACCAGG - Intergenic
1014398331 6:120954301-120954323 ACCAAACAAAACAAGAAAAGAGG - Intergenic
1014533337 6:122587006-122587028 AACAAACTAAATAAGCAATGTGG + Intronic
1014757435 6:125317029-125317051 AACAAACAAACAAAGAAAACAGG - Intergenic
1015105756 6:129534094-129534116 AACAAACAAAATAAGCCAGATGG - Intergenic
1015367417 6:132412276-132412298 AGCAAACAAAATATACAAACGGG - Intergenic
1015610966 6:135017986-135018008 AACAAACAAAAAAAAAAAACAGG + Intronic
1016118550 6:140318629-140318651 ATCAAATCAAATAAACAAACAGG + Intergenic
1016155283 6:140798746-140798768 GCTAAACTAAATAAGAAAACAGG - Intergenic
1016268784 6:142263285-142263307 AACAAACAAACTAACAAAACAGG + Intergenic
1016584652 6:145670312-145670334 ATCATATAAATTAAGCAAACTGG - Intronic
1016604776 6:145907799-145907821 ACAAAACAAAACAAAAAAACAGG + Intronic
1017336203 6:153263312-153263334 ACAAAACAAAACAAACAGACTGG + Intergenic
1017551277 6:155510657-155510679 ACCAAAAAAAAAAAAAAAACTGG - Intergenic
1018255420 6:161913247-161913269 TCAAAAGAAAATCAGCAAACTGG + Intronic
1018288775 6:162268996-162269018 ACAAAACAAAACAAACAAAAAGG + Intronic
1018375821 6:163211775-163211797 AACTAGGAAAATAAGCAAACAGG + Intronic
1018917471 6:168145529-168145551 AACAAACTAAATAAGCCACCAGG - Intergenic
1019203812 6:170342141-170342163 ACCAAAAAAACTCAGAAAACTGG - Intronic
1019745494 7:2698240-2698262 AACAAGCAAAAAAACCAAACAGG + Intronic
1020021006 7:4868824-4868846 ACAAAACAAAACAAAAAAACAGG + Intronic
1020485232 7:8713446-8713468 ACCAAACAAACTAAGGCACCAGG - Intronic
1020826621 7:13036810-13036832 CCCAAATAACATAAGCAAAGGGG - Intergenic
1020858138 7:13453908-13453930 CCCAAACAAAATAGACAGACAGG + Intergenic
1021605876 7:22409177-22409199 AGCAAACAAAATAAACAATCTGG + Intergenic
1021680919 7:23130906-23130928 AACAAACACAATTAGTAAACAGG + Intronic
1022266943 7:28766174-28766196 AACAAAGAAAATAAGCATAGTGG - Intronic
1022387137 7:29911912-29911934 AGAAGAAAAAATAAGCAAACTGG + Intronic
1022676128 7:32500871-32500893 ACCTGACAAAATAAGCAATGGGG - Intronic
1023738782 7:43258919-43258941 ACAAAACAAAAAAAACAAACTGG - Intronic
1024545687 7:50515523-50515545 AACAAACAAAAAAAGTACACAGG + Intronic
1024836269 7:53522503-53522525 AACAAATAAAACAAGGAAACTGG + Intergenic
1025068390 7:55877337-55877359 TCCAAAGAAAATATACAAACGGG + Intergenic
1025149031 7:56532476-56532498 ACCAAACACAAATAGCAAAGTGG + Intergenic
1025924621 7:65947147-65947169 ACAAAACAAAACAAACAAAAAGG + Intronic
1026005227 7:66595254-66595276 AACAAACAAAAAAATCAAATGGG - Intergenic
1026818283 7:73529315-73529337 ACAAAACAAAACAAAAAAACTGG - Intergenic
1026887527 7:73961834-73961856 ACCAAACAAAATACGTGAAGCGG - Intergenic
1027727216 7:81822540-81822562 ACAAAACAAAACAAAAAAACAGG - Intergenic
1027774723 7:82449673-82449695 TCCAAACAAAAACAGTAAACTGG + Intergenic
1027816827 7:82984626-82984648 AATAAACAAAATAACGAAACAGG - Intronic
1027867466 7:83665655-83665677 AACAAACAAAAAATGTAAACAGG - Intergenic
1028503513 7:91546147-91546169 ACCAAAGAAGATATGCAAATGGG + Intergenic
1028556586 7:92132871-92132893 ATCAAACAAAATAATGAAAAAGG + Intronic
1029050803 7:97684663-97684685 AACAAACTAAAGAAGCAAACAGG + Intergenic
1029076408 7:97938066-97938088 ACAAAACAAAAAAAAAAAACTGG + Intergenic
1029366186 7:100118056-100118078 AAAAAACAAAAAAAGCAAAGTGG + Intronic
1029609706 7:101620329-101620351 ACAAAACAAAATAAACAAAGAGG + Intronic
1030689905 7:112521456-112521478 ACAAAACAAAACAAAAAAACAGG + Intergenic
1030780013 7:113588898-113588920 ATTAAACAAACTAAGCAAAAAGG + Intergenic
1031231473 7:119113484-119113506 GCCAAATAAAATAAGCTACCAGG - Intergenic
1031748013 7:125529822-125529844 ACAAAACAAAACAAAAAAACTGG - Intergenic
1031781267 7:125968860-125968882 AGCAAACAAAATAACCATAATGG - Intergenic
1031783642 7:126001288-126001310 AATAAAGAAAAAAAGCAAACAGG + Intergenic
1031906569 7:127466496-127466518 ACAAAACAAAACAAAAAAACAGG - Intergenic
1032311638 7:130792886-130792908 ACCAAACAAACAAATAAAACAGG - Intergenic
1032686375 7:134238320-134238342 AATAAACAAAACAAGGAAACAGG - Intronic
1033096085 7:138432287-138432309 ACAAAACAAAACAAAAAAACAGG + Intergenic
1033331608 7:140421351-140421373 ACAAAACAAAACAACCTAACTGG - Intronic
1033484874 7:141778725-141778747 ACAACACAAAAAAAGCAGACAGG - Exonic
1033947652 7:146741520-146741542 GACAAAGAAGATAAGCAAACAGG + Intronic
1034206485 7:149320311-149320333 ACCAAACAAAATATTAAACCAGG - Intergenic
1034219182 7:149431332-149431354 ACCAAACAAAAACGGCAAACAGG + Intergenic
1034237198 7:149581149-149581171 ACGAAACAAAACAAAAAAACTGG + Intergenic
1034420016 7:150985481-150985503 AACAAAAACAATAAACAAACAGG + Intergenic
1035113130 7:156501136-156501158 ACCTGACAAAATAAGCAATGGGG - Intergenic
1035895091 8:3390948-3390970 AGCCAAGAAATTAAGCAAACTGG + Intronic
1036954461 8:13172338-13172360 ACCAAAGAAAGGAAGCCAACAGG + Intronic
1037864127 8:22429279-22429301 AACAAACAAAAAAAGAACACAGG + Intronic
1037899107 8:22677201-22677223 ACAAAAAAAAAAATGCAAACAGG + Intergenic
1038194587 8:25355447-25355469 TCAAAACAAAATAAATAAACAGG - Intronic
1038316532 8:26489185-26489207 ACCAAACAAGAGAAGGAAGCCGG - Intronic
1038547129 8:28434261-28434283 AACAAACAAAAAAATCAATCAGG - Intronic
1038960651 8:32515439-32515461 ACAAAACAAAACAAAAAAACTGG - Intronic
1039265445 8:35818337-35818359 AACAAACAAAAAAAAAAAACAGG + Intergenic
1039506077 8:38053316-38053338 ACAAAACAAAACAAAAAAACAGG - Intronic
1039747740 8:40445333-40445355 ACTGAAGAAAATAAGCCAACTGG - Intergenic
1039787553 8:40847212-40847234 AACAAACAAAAAAAAAAAACTGG + Intronic
1039985536 8:42444682-42444704 GCCACACAAAAAAAGCGAACAGG + Exonic
1040096076 8:43444236-43444258 AACAAAGGAAATAAGCAAAATGG - Intergenic
1040401688 8:47056860-47056882 AACAAACAAAATTAACAAACTGG + Intergenic
1040631365 8:49216651-49216673 ACCTAAAAAAATAGGCAAATGGG - Intergenic
1040755155 8:50764252-50764274 ACAACAAAAAATAAACAAACAGG + Intronic
1041141421 8:54823628-54823650 AGCAATAAAAAAAAGCAAACTGG - Intergenic
1041730266 8:61055439-61055461 ACCAAAGTAAATTAGCAAAAAGG - Intergenic
1042299803 8:67265309-67265331 AGCAAACCAAGTAAGCACACAGG + Intronic
1042690654 8:71494335-71494357 CTAAAAAAAAATAAGCAAACTGG - Intronic
1042698035 8:71580104-71580126 AACAAACAAAATAAAAAACCTGG + Intronic
1043947736 8:86273632-86273654 ACTAAACCAAATAATGAAACAGG + Intronic
1044208607 8:89522427-89522449 AGCAAACAAAAGAAGAAAAAGGG + Intergenic
1044620373 8:94185409-94185431 ACAAAACAAAAAAAGAAAAGTGG + Intronic
1044777934 8:95713238-95713260 CCCAAAGAAAATAAGCAGAGGGG + Intergenic
1044825428 8:96191775-96191797 ACCTGACAAAATAAGCAATGGGG - Intergenic
1044923869 8:97193127-97193149 ACCAAGCAAAAGAAGAAATCTGG + Intergenic
1045008677 8:97938049-97938071 AACAGACAAAATAAGAAGACAGG - Intronic
1045254281 8:100506645-100506667 AGTAAACAAAATAAACAAGCAGG - Intergenic
1045324232 8:101105390-101105412 ACCAAACAGAAAAAGAAACCCGG + Intergenic
1045462239 8:102435247-102435269 ACAAAACAAAACAAAAAAACAGG + Intergenic
1045632710 8:104145111-104145133 ACAAAACAAAATAAGACAAGGGG - Intronic
1045684551 8:104699101-104699123 ACCAAGCAAAATAAGACCACTGG - Intronic
1045746468 8:105428278-105428300 ACAAAACCAAATAAACAAAAAGG + Intronic
1045846586 8:106644166-106644188 AACAAACAACAAAAGCAAAATGG - Intronic
1046108084 8:109691084-109691106 ACCAATCAAACCAATCAAACAGG + Intronic
1046177367 8:110595679-110595701 ACCAAAAAAAAAAAAAAAACAGG + Intergenic
1046720360 8:117612190-117612212 AGAAAAGAAAATAAGCAACCTGG + Intergenic
1046843922 8:118893495-118893517 ACAAAACAAAACAAAAAAACAGG + Intergenic
1046957993 8:120081476-120081498 ACAAAACAAAACAAAAAAACAGG - Intronic
1047023354 8:120800729-120800751 TACAAAAAAACTAAGCAAACAGG + Intronic
1047123809 8:121937273-121937295 ATCAAACAAAATGAGAAAAATGG - Intergenic
1048986055 8:139735655-139735677 ACAAAACAAAAAAAAAAAACAGG - Intronic
1049635639 8:143687311-143687333 AACAAACAAAAAACACAAACTGG - Intronic
1049877674 8:145036185-145036207 ACCAAGCAGAAGAAGCAAAGAGG - Intergenic
1050183798 9:2949777-2949799 ACGAAACAAAAGATGCAATCTGG - Intergenic
1050516340 9:6447830-6447852 AACAAACAAAGCAAGCAAATTGG + Intronic
1050735281 9:8755227-8755249 AAAAAACAAAAAAAACAAACAGG + Intronic
1050872795 9:10595077-10595099 ACGAAACAATATAAGCAAATTGG - Intronic
1051541342 9:18222523-18222545 AACAAAAACAGTAAGCAAACTGG - Intergenic
1051767061 9:20536192-20536214 ACAAAACAAAACAAAAAAACTGG + Intronic
1051828277 9:21246574-21246596 ACAAAACAAAAAAACCAAGCTGG + Intergenic
1052502738 9:29312974-29312996 ACCAAAATAAATAAGTAAATAGG - Intergenic
1052667772 9:31517199-31517221 ACAAAACAAAACAAAAAAACAGG - Intergenic
1053507380 9:38654818-38654840 ACCAAACAAAACAAAAAAACTGG - Intergenic
1054164410 9:61707820-61707842 ACCAAAGAAGATATGCAAATGGG + Intergenic
1054707841 9:68480714-68480736 ACAAAACAAAACAAAAAAACAGG + Intronic
1054909507 9:70441210-70441232 ACAAAACAAAACAAAGAAACAGG + Intergenic
1055102050 9:72476017-72476039 ACAAAAAAAAAAAACCAAACTGG + Intergenic
1055599309 9:77899089-77899111 ACAAAACAAAACAAAAAAACGGG - Intronic
1055824951 9:80312882-80312904 AGCAAACAAAATCAGAAAATTGG + Intergenic
1056018328 9:82415957-82415979 ACCAAAAAAAAAAAAAAAACTGG + Intergenic
1056289291 9:85126688-85126710 CCCAAACATACTAAGCCAACGGG + Intergenic
1056320798 9:85433023-85433045 TCCAAACAAAATAAGGAACTAGG + Intergenic
1056472380 9:86918463-86918485 ACAAAACAAAACAAAAAAACAGG + Intergenic
1056951899 9:91046677-91046699 ACAAAACAAAACAAAAAAACAGG + Intergenic
1057049988 9:91916308-91916330 CCTGAACAAAATAAGCTAACAGG - Intronic
1057204207 9:93161212-93161234 ACAAAACAAAACAAAAAAACAGG + Intergenic
1057641543 9:96827784-96827806 ACCAAACAAAATATAAAAAATGG + Intronic
1057934265 9:99223326-99223348 AACAAACAAAAAAAAAAAACCGG + Intronic
1058109938 9:101021321-101021343 ACAAAACAAAACAAAAAAACAGG - Intergenic
1058313986 9:103541333-103541355 GTCACACAAAATAAGAAAACTGG + Intergenic
1058328547 9:103728498-103728520 TCCAAAAAAAATAAACAAACAGG - Intergenic
1058360890 9:104144666-104144688 AACAAACAAAAAAAAAAAACTGG - Intergenic
1059355166 9:113693196-113693218 ACCAAAAAAAACAAACACACAGG - Intergenic
1059477973 9:114563222-114563244 AATACACAAAATAAGAAAACAGG - Intergenic
1059746748 9:117208307-117208329 ACCATAAAAAAGAACCAAACAGG + Intronic
1060663468 9:125418058-125418080 ACAAAACAAAACAAGAACACTGG + Intergenic
1060920975 9:127420102-127420124 AACAAACAAAAGAATTAAACAGG + Intergenic
1061252533 9:129435075-129435097 ACAAAACAAAACAAAAAAACAGG - Intergenic
1061299274 9:129695459-129695481 ACCAAACCAAAGAAGCACATTGG - Intronic
1061383418 9:130273940-130273962 ACAAAACAAAAAATCCAAACAGG + Intergenic
1061732544 9:132627319-132627341 ACCACACACCCTAAGCAAACAGG + Intronic
1061756732 9:132818685-132818707 ACAAAACAAAACAAAAAAACAGG + Intronic
1061760661 9:132848898-132848920 AAAAAAAAAAAAAAGCAAACAGG - Intronic
1061976903 9:134073195-134073217 ACAAAACAAAACAAAAAAACAGG + Intergenic
1185574358 X:1158283-1158305 ACAAAACAAAACAAAAAAACAGG + Intergenic
1185796033 X:2965198-2965220 AACAAACAAAAGAAGTAAAAAGG + Intronic
1186885831 X:13912874-13912896 CGGAAACAAAATAAACAAACTGG - Intronic
1187284536 X:17891881-17891903 AACAAACAAAACAAACAAAAAGG + Intergenic
1187547049 X:20265759-20265781 CCCAAACAATATACCCAAACAGG - Intronic
1187893404 X:23958560-23958582 ACCAAATAAAATATACAAATGGG - Intergenic
1187934656 X:24323981-24324003 ACCAAACAAAATAAGAACTATGG - Intergenic
1187992042 X:24885185-24885207 ACTAAAAAAAATAAGCAGACAGG - Intronic
1188599534 X:31944636-31944658 ACAAAACAAAACAAACAAACAGG - Intronic
1188664762 X:32805080-32805102 ACCAAACAAGAGAACAAAACTGG + Intronic
1188901477 X:35737879-35737901 AATAAATAAAATAAGTAAACAGG + Intergenic
1189097775 X:38158222-38158244 AGCAAACAACACAGGCAAACAGG + Intronic
1189107328 X:38250483-38250505 AACAAGCAAAATAAACAAAAAGG + Intronic
1189110148 X:38280911-38280933 ACCAAACAAAATAAGTCTGCAGG + Intronic
1189642047 X:43083404-43083426 AACAAAGAAAATAGGCAAATAGG - Intergenic
1190014049 X:46811355-46811377 ACAAAACAAAACAAATAAACAGG + Intergenic
1190019696 X:46862677-46862699 AACAAACAAAAAAACCCAACAGG + Intronic
1190568154 X:51752039-51752061 AGCAAACAGTATAAACAAACAGG - Intergenic
1190625288 X:52331383-52331405 TCTAAGCAAAATAAGCAACCAGG + Intergenic
1190804413 X:53821351-53821373 AGAGACCAAAATAAGCAAACAGG + Intergenic
1191046021 X:56137832-56137854 ACCAAAAGAAATAACCAAACTGG + Intergenic
1191671480 X:63752375-63752397 ACAAAACAAAACAAAAAAACAGG + Intronic
1191764578 X:64683401-64683423 ACAAAACAAAAAAACCTAACAGG - Intergenic
1191827059 X:65376911-65376933 ACCAAACTAAATAAGGCACCAGG + Intronic
1192902804 X:75518033-75518055 ACCAAACAAAAAAATCCCACAGG + Intronic
1193014656 X:76719100-76719122 AACAAACAAAAAAAACTAACCGG + Intergenic
1193035322 X:76944252-76944274 ACAAAAAAAAATAAGCAATGGGG - Intergenic
1193167376 X:78296339-78296361 CCTAAGCAAAATAAGAAAACTGG - Intronic
1193252201 X:79304625-79304647 ACCAACCAAAACAAGCAATGAGG + Intergenic
1193297018 X:79845515-79845537 ACCAAACAAACTAAGATACCAGG - Intergenic
1193611933 X:83643106-83643128 ACCACACAACATAATCAAGCAGG - Intergenic
1193854449 X:86581553-86581575 ACAAAACAAAACAAAAAAACAGG + Intronic
1193993334 X:88335786-88335808 ACAGAATAAAATAAGGAAACAGG + Intergenic
1194004151 X:88469764-88469786 GCCAAGCATAATAAGCAAACCGG + Intergenic
1194027872 X:88776448-88776470 ACCTGACAAAATAAGCAATGGGG - Intergenic
1194071703 X:89331808-89331830 ACCAAACAACACAAGTAAAATGG - Intergenic
1194087756 X:89550252-89550274 ACCAATGAATATAAGGAAACAGG + Intergenic
1194217117 X:91144349-91144371 GCCAACAAAAATAAGCAATCAGG - Intergenic
1194495203 X:94607931-94607953 ACCAAACAAAAATAGACAACTGG - Intergenic
1194910272 X:99632681-99632703 ACAAAACAAAACAAAAAAACAGG - Intergenic
1194964741 X:100274576-100274598 ACCAATCAAAATAAGAAAGAGGG + Intergenic
1195199912 X:102538929-102538951 ACCAAACTAAATAAGGCACCAGG - Intergenic
1195436571 X:104851290-104851312 ATCAAACAAAATATTAAAACAGG + Intronic
1195458814 X:105100546-105100568 ACCAAGTAAAATAAGCATAAAGG - Intronic
1197409591 X:126098838-126098860 ACCAAAGAATATAAGGAAGCTGG - Intergenic
1197449686 X:126596136-126596158 AAGAAACAAAATAAGAAAACAGG + Intergenic
1197557484 X:127974547-127974569 ACAAAACAAAAGAAAAAAACAGG - Intergenic
1197882480 X:131181417-131181439 ATCACAAAAAATAAGTAAACTGG - Intergenic
1197932122 X:131706636-131706658 ACAAAACAAAACAAAAAAACTGG + Intergenic
1198389548 X:136160410-136160432 AACAAACAAAAAAACTAAACAGG - Intronic
1198581088 X:138065326-138065348 ACCAAAAAAACAAAGCAAATGGG - Intergenic
1200374778 X:155767898-155767920 ACAAAACAAAACAAAAAAACGGG - Exonic
1200408001 Y:2833438-2833460 ACAAAACAAAACAAAAAAACCGG + Intergenic
1200553634 Y:4608141-4608163 GCCAACAAAAATAAGCAATCAGG - Intergenic
1200568845 Y:4802720-4802742 ACTAGAGAAAATAAGCCAACGGG - Intergenic
1200725949 Y:6667537-6667559 ACCAAACAACACAAGTAAAATGG - Intergenic
1200847033 Y:7840859-7840881 AAGAATCAAAAGAAGCAAACTGG - Intergenic
1201339689 Y:12920973-12920995 AACAAACACGATAGGCAAACTGG + Intergenic
1201344778 Y:12970573-12970595 ACAATACAAAAAAAGTAAACTGG + Intergenic
1201396068 Y:13550437-13550459 CCCAAGCAAAATGAACAAACGGG - Intergenic
1201971328 Y:19799895-19799917 ACTGAACAAAATAACAAAACTGG + Intergenic