ID: 1141400497

View in Genome Browser
Species Human (GRCh38)
Location 16:83742918-83742940
Sequence AGCAAACTGGCCAGGTGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9183
Summary {0: 1, 1: 18, 2: 162, 3: 1349, 4: 7653}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141400492_1141400497 4 Left 1141400492 16:83742891-83742913 CCATGGGAGGAGGCACCAAACAA No data
Right 1141400497 16:83742918-83742940 AGCAAACTGGCCAGGTGCGGTGG 0: 1
1: 18
2: 162
3: 1349
4: 7653
1141400487_1141400497 19 Left 1141400487 16:83742876-83742898 CCTCCTTGAGGTCTCCCATGGGA 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1141400497 16:83742918-83742940 AGCAAACTGGCCAGGTGCGGTGG 0: 1
1: 18
2: 162
3: 1349
4: 7653
1141400491_1141400497 5 Left 1141400491 16:83742890-83742912 CCCATGGGAGGAGGCACCAAACA 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1141400497 16:83742918-83742940 AGCAAACTGGCCAGGTGCGGTGG 0: 1
1: 18
2: 162
3: 1349
4: 7653
1141400489_1141400497 16 Left 1141400489 16:83742879-83742901 CCTTGAGGTCTCCCATGGGAGGA 0: 1
1: 0
2: 6
3: 15
4: 152
Right 1141400497 16:83742918-83742940 AGCAAACTGGCCAGGTGCGGTGG 0: 1
1: 18
2: 162
3: 1349
4: 7653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141400497 Original CRISPR AGCAAACTGGCCAGGTGCGG TGG Intronic
Too many off-targets to display for this crispr