ID: 1141409225

View in Genome Browser
Species Human (GRCh38)
Location 16:83821188-83821210
Sequence TATGAAGGAGTCCTCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141409223_1141409225 8 Left 1141409223 16:83821157-83821179 CCGCGTAGTCATTTTCAGTGAGA No data
Right 1141409225 16:83821188-83821210 TATGAAGGAGTCCTCTCTGCTGG No data
1141409222_1141409225 17 Left 1141409222 16:83821148-83821170 CCAAAATGACCGCGTAGTCATTT No data
Right 1141409225 16:83821188-83821210 TATGAAGGAGTCCTCTCTGCTGG No data
1141409220_1141409225 30 Left 1141409220 16:83821135-83821157 CCCTCACTGGGCTCCAAAATGAC No data
Right 1141409225 16:83821188-83821210 TATGAAGGAGTCCTCTCTGCTGG No data
1141409221_1141409225 29 Left 1141409221 16:83821136-83821158 CCTCACTGGGCTCCAAAATGACC No data
Right 1141409225 16:83821188-83821210 TATGAAGGAGTCCTCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141409225 Original CRISPR TATGAAGGAGTCCTCTCTGC TGG Intergenic
No off target data available for this crispr