ID: 1141412030

View in Genome Browser
Species Human (GRCh38)
Location 16:83841759-83841781
Sequence GAAGGGTCTATCCAGTTGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141412028_1141412030 -9 Left 1141412028 16:83841745-83841767 CCCTTGGCGTACAGGAAGGGTCT No data
Right 1141412030 16:83841759-83841781 GAAGGGTCTATCCAGTTGATCGG No data
1141412029_1141412030 -10 Left 1141412029 16:83841746-83841768 CCTTGGCGTACAGGAAGGGTCTA No data
Right 1141412030 16:83841759-83841781 GAAGGGTCTATCCAGTTGATCGG No data
1141412022_1141412030 24 Left 1141412022 16:83841712-83841734 CCTGAACCAGTGTTTCAGGTTTA No data
Right 1141412030 16:83841759-83841781 GAAGGGTCTATCCAGTTGATCGG No data
1141412023_1141412030 18 Left 1141412023 16:83841718-83841740 CCAGTGTTTCAGGTTTACTTTAG No data
Right 1141412030 16:83841759-83841781 GAAGGGTCTATCCAGTTGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141412030 Original CRISPR GAAGGGTCTATCCAGTTGAT CGG Intergenic
No off target data available for this crispr