ID: 1141412895

View in Genome Browser
Species Human (GRCh38)
Location 16:83847640-83847662
Sequence TGTACCTTGTGAAATGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141412892_1141412895 1 Left 1141412892 16:83847616-83847638 CCATGGCTCAGCAGCTCCTCCTA No data
Right 1141412895 16:83847640-83847662 TGTACCTTGTGAAATGCTATAGG No data
1141412891_1141412895 2 Left 1141412891 16:83847615-83847637 CCCATGGCTCAGCAGCTCCTCCT No data
Right 1141412895 16:83847640-83847662 TGTACCTTGTGAAATGCTATAGG No data
1141412890_1141412895 3 Left 1141412890 16:83847614-83847636 CCCCATGGCTCAGCAGCTCCTCC No data
Right 1141412895 16:83847640-83847662 TGTACCTTGTGAAATGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141412895 Original CRISPR TGTACCTTGTGAAATGCTAT AGG Intergenic
No off target data available for this crispr