ID: 1141416922

View in Genome Browser
Species Human (GRCh38)
Location 16:83882836-83882858
Sequence ATGTGAAATGGGAAGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141416913_1141416922 21 Left 1141416913 16:83882792-83882814 CCTGAAAGGGTGGGCAAAGCTGG No data
Right 1141416922 16:83882836-83882858 ATGTGAAATGGGAAGTTTTGGGG No data
1141416911_1141416922 23 Left 1141416911 16:83882790-83882812 CCCCTGAAAGGGTGGGCAAAGCT No data
Right 1141416922 16:83882836-83882858 ATGTGAAATGGGAAGTTTTGGGG No data
1141416912_1141416922 22 Left 1141416912 16:83882791-83882813 CCCTGAAAGGGTGGGCAAAGCTG No data
Right 1141416922 16:83882836-83882858 ATGTGAAATGGGAAGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141416922 Original CRISPR ATGTGAAATGGGAAGTTTTG GGG Intergenic
No off target data available for this crispr