ID: 1141417210

View in Genome Browser
Species Human (GRCh38)
Location 16:83884980-83885002
Sequence TGTTTGGTATATACCTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141417202_1141417210 25 Left 1141417202 16:83884932-83884954 CCTGCCCACCGCAAAACATGTAT No data
Right 1141417210 16:83884980-83885002 TGTTTGGTATATACCTTGGAGGG No data
1141417203_1141417210 21 Left 1141417203 16:83884936-83884958 CCCACCGCAAAACATGTATTTTG No data
Right 1141417210 16:83884980-83885002 TGTTTGGTATATACCTTGGAGGG No data
1141417204_1141417210 20 Left 1141417204 16:83884937-83884959 CCACCGCAAAACATGTATTTTGG No data
Right 1141417210 16:83884980-83885002 TGTTTGGTATATACCTTGGAGGG No data
1141417201_1141417210 26 Left 1141417201 16:83884931-83884953 CCCTGCCCACCGCAAAACATGTA No data
Right 1141417210 16:83884980-83885002 TGTTTGGTATATACCTTGGAGGG No data
1141417206_1141417210 17 Left 1141417206 16:83884940-83884962 CCGCAAAACATGTATTTTGGTGA No data
Right 1141417210 16:83884980-83885002 TGTTTGGTATATACCTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141417210 Original CRISPR TGTTTGGTATATACCTTGGA GGG Intergenic
No off target data available for this crispr