ID: 1141418955

View in Genome Browser
Species Human (GRCh38)
Location 16:83899325-83899347
Sequence CACTGACCCTCGGCGGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 76}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141418955_1141418961 4 Left 1141418955 16:83899325-83899347 CCGGCGCCCGCCGAGGGTCAGTG 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1141418961 16:83899352-83899374 GACTTCGTGAGCTTCTACGGTGG 0: 1
1: 0
2: 0
3: 2
4: 21
1141418955_1141418965 26 Left 1141418955 16:83899325-83899347 CCGGCGCCCGCCGAGGGTCAGTG 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1141418965 16:83899374-83899396 GGCTGGCCGAGACGGCCCAGCGG 0: 1
1: 0
2: 0
3: 13
4: 139
1141418955_1141418960 1 Left 1141418955 16:83899325-83899347 CCGGCGCCCGCCGAGGGTCAGTG 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1141418960 16:83899349-83899371 GCGGACTTCGTGAGCTTCTACGG 0: 1
1: 0
2: 0
3: 1
4: 18
1141418955_1141418963 9 Left 1141418955 16:83899325-83899347 CCGGCGCCCGCCGAGGGTCAGTG 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1141418963 16:83899357-83899379 CGTGAGCTTCTACGGTGGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 60
1141418955_1141418966 27 Left 1141418955 16:83899325-83899347 CCGGCGCCCGCCGAGGGTCAGTG 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1141418966 16:83899375-83899397 GCTGGCCGAGACGGCCCAGCGGG 0: 1
1: 0
2: 2
3: 9
4: 151
1141418955_1141418962 5 Left 1141418955 16:83899325-83899347 CCGGCGCCCGCCGAGGGTCAGTG 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1141418962 16:83899353-83899375 ACTTCGTGAGCTTCTACGGTGGG 0: 1
1: 0
2: 0
3: 1
4: 24
1141418955_1141418964 18 Left 1141418955 16:83899325-83899347 CCGGCGCCCGCCGAGGGTCAGTG 0: 1
1: 0
2: 1
3: 6
4: 76
Right 1141418964 16:83899366-83899388 CTACGGTGGGCTGGCCGAGACGG 0: 1
1: 0
2: 1
3: 2
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141418955 Original CRISPR CACTGACCCTCGGCGGGCGC CGG (reversed) Exonic
900119937 1:1044271-1044293 CCCTGGCTCTCGGCGGGCGGCGG + Intronic
900625491 1:3606724-3606746 CACTTACCCACGGCGAGCCCTGG + Intronic
903601700 1:24546697-24546719 CACTGACCCTCTGCCCTCGCTGG + Intergenic
910760534 1:90727326-90727348 CACAGTCCCTCGGCAGGCCCTGG + Intergenic
915634073 1:157174218-157174240 CACTGACGTTGGGCGGGAGCTGG + Intergenic
920634013 1:207681195-207681217 CACTGTCCCTCTTCGGGCCCTGG + Intronic
1065022984 10:21516440-21516462 CACTGACACTTGGCTGGAGCCGG + Exonic
1065140496 10:22714542-22714564 CGCGGATCCGCGGCGGGCGCAGG - Exonic
1071292018 10:84195183-84195205 CACTGCCCCTCTCCGAGCGCGGG + Intronic
1077282290 11:1751184-1751206 CAGTGACCCTGGGCAGGCCCTGG - Intronic
1083665473 11:64271797-64271819 CACTGACCCTCTGCAGGCGCTGG - Exonic
1084310300 11:68312790-68312812 CACCTACCCGCGGCGGGGGCCGG - Exonic
1084403284 11:68956936-68956958 AGCTGACCCTCGGTGGGCCCAGG + Intergenic
1087634463 11:100687219-100687241 CCCTCCCCCTCGGCGGACGCAGG - Intergenic
1102197133 12:111033924-111033946 CCCCGACCCCCGGAGGGCGCGGG - Intergenic
1103689045 12:122755738-122755760 CACTGACCCTCTGAGGTCACAGG - Intronic
1103935298 12:124473056-124473078 CACTGACCCTGAGCTGGAGCTGG - Exonic
1104954219 12:132456626-132456648 CACAGACCCTCGGCAAGCACAGG + Intergenic
1105707990 13:22980661-22980683 CACTGACCCTCTAGGGGTGCTGG - Intergenic
1106735948 13:32587245-32587267 CACTGTCCCTCGCCGCTCGCCGG + Intronic
1107454964 13:40546424-40546446 AACAGACCCTCCGCGGGGGCTGG + Intergenic
1107467554 13:40664840-40664862 GTGTGACCCTCGGCGGGGGCGGG - Intronic
1107841291 13:44459883-44459905 CACTGACCCTTGGCAGGCATGGG + Intronic
1111235759 13:85405729-85405751 CACTGACCCTCTGCCGCTGCTGG - Intergenic
1111657817 13:91175013-91175035 CACTGTCCCTCGCCGGCCCCGGG + Intergenic
1112563251 13:100532245-100532267 CACTGCACCGCGGTGGGCGCTGG + Exonic
1120905689 14:89619173-89619195 CGCCGACCCCGGGCGGGCGCCGG - Intergenic
1122108898 14:99481255-99481277 CACTGACCCGCGGGGCGGGCGGG + Intronic
1122738760 14:103858713-103858735 CACTGAGCCCAGGCAGGCGCAGG + Intergenic
1125603227 15:40926706-40926728 CACTGACCCTCCGCAGGCCCAGG - Intergenic
1127672661 15:61210911-61210933 CCCTGACCCTCAGCTGTCGCTGG + Intronic
1128153499 15:65377679-65377701 CACTCACCCTCGCTCGGCGCGGG + Exonic
1128398610 15:67254501-67254523 CCCTGAGCCTCAGCGGGCGACGG - Intronic
1129116500 15:73368083-73368105 CCCTCCCCCTCGGCGGCCGCGGG - Exonic
1132577630 16:671300-671322 CACTGACCCTCAGGGAGGGCAGG - Intronic
1132603668 16:784778-784800 CACAGACCCTGGGCCGGCCCCGG - Intergenic
1132724707 16:1333734-1333756 CACTTACCGTGGGCCGGCGCGGG - Intronic
1132928328 16:2445124-2445146 CCCTGACCCTCGGGGCGTGCAGG - Intronic
1134490805 16:14694126-14694148 CACTCACCCTCGCCGGACCCGGG + Exonic
1134496186 16:14733244-14733266 CACTCACCCTCGCCGGACCCGGG + Intronic
1138450976 16:57093166-57093188 CCCTGGCTCTCGGCGGGCGCTGG + Intronic
1141418955 16:83899325-83899347 CACTGACCCTCGGCGGGCGCCGG - Exonic
1143146793 17:4781879-4781901 CAGTGAATCTCGGCGGCCGCTGG - Intronic
1145153241 17:20523257-20523279 CACTGACCCTCAGAGGACCCTGG - Intergenic
1152751027 17:82062464-82062486 CACTGAGCCTGGCCTGGCGCGGG - Intronic
1152925296 17:83084862-83084884 CACTGACTCTCTGTGGGTGCGGG + Intronic
1159511529 18:69401900-69401922 CAGTGACCGCGGGCGGGCGCGGG - Intronic
1160021520 18:75185314-75185336 CACTGCCCCTCGGTGGGCACTGG + Intergenic
1160541802 18:79628009-79628031 CAAGGACCCCTGGCGGGCGCTGG - Intergenic
1163692571 19:18745512-18745534 CCCTGGCACCCGGCGGGCGCTGG + Intronic
1164895685 19:31875596-31875618 CGCTGACCAACAGCGGGCGCAGG + Intergenic
928309201 2:30195653-30195675 CGCTGACCCTTGGCTGGAGCAGG + Intergenic
928738571 2:34322369-34322391 CACTGCCCCTCGACAGGCCCTGG - Intergenic
935960831 2:108424054-108424076 CACTGGCCCTCAGCGGCTGCTGG - Intergenic
938122818 2:128645722-128645744 CACTGACCCTCTCTGGGAGCTGG - Intergenic
942459108 2:176157417-176157439 CCCCGGCCCCCGGCGGGCGCGGG + Intronic
947117947 2:226791679-226791701 GGCTGAGCCGCGGCGGGCGCGGG - Intronic
948064115 2:235063861-235063883 CACAGACCCTCGGCCGGGTCAGG - Intergenic
1169229052 20:3874894-3874916 CACTGACCCTAGGGGGGTGTAGG - Exonic
1174138127 20:48394500-48394522 CACTCACCCTCTGAGGGCCCGGG - Intergenic
1174458971 20:50669584-50669606 CACTGACCCTCTGGGGGCTTGGG + Intronic
1176112344 20:63416351-63416373 CACTGTCGCCCGGCGGACGCTGG - Intronic
1179716616 21:43291793-43291815 CAGTGACCCTCCGGGGGCACAGG + Intergenic
1180171954 21:46064130-46064152 CACTGATCCTGGACGGGCTCCGG - Intergenic
1180342479 22:11629256-11629278 CACTCACGCGCGGCGGGCGCGGG - Intergenic
961621039 3:128225282-128225304 CACTGACCCAGGGCTGGGGCTGG - Intronic
968588436 4:1445801-1445823 CACAGACACTCGGCGAGGGCAGG - Intergenic
984973519 4:185210240-185210262 TACTTACCCCCGGCGGGCGGCGG - Intronic
996748600 5:126867446-126867468 CACTGACCCTGGCTGGGCTCTGG - Intergenic
1002888964 6:1317388-1317410 GAGTGACCCTCGGCCGACGCGGG + Intergenic
1003124232 6:3342750-3342772 CACTGACCCTAGGAGGGTGGAGG - Intronic
1011042956 6:83051292-83051314 CCCTGACCATCGGCAGGCCCTGG - Intronic
1018434170 6:163746239-163746261 CGCTGTCACTCGGCGGGCTCAGG + Intergenic
1019498064 7:1349705-1349727 CACTGACCCCCGCCCGGGGCTGG - Intergenic
1019527967 7:1489312-1489334 CACGTCCCCTCGGCGGGCCCGGG - Intronic
1019657010 7:2201264-2201286 CTCTGGCCCTCGGCTGGCGCTGG + Intronic
1020207497 7:6130421-6130443 CTCTGACCCTCACCGGGGGCTGG + Intronic
1029996773 7:105014216-105014238 CAGTGACACTGAGCGGGCGCAGG + Exonic
1032842802 7:135727364-135727386 CCCAGACCCCCGGTGGGCGCAGG + Intronic
1035519479 8:265919-265941 CACTGACCCCTGGCGGCCGCGGG - Intergenic
1061485607 9:130919115-130919137 TGCTGAGCCACGGCGGGCGCGGG + Intronic
1062310451 9:135932861-135932883 CTCTGACCCGGGGCGGGCACCGG - Intergenic
1185582484 X:1221621-1221643 CAGTGACCCTGGGGCGGCGCTGG - Intergenic
1190881460 X:54495401-54495423 CACCGAGCCCCGGGGGGCGCCGG - Exonic