ID: 1141421640

View in Genome Browser
Species Human (GRCh38)
Location 16:83921462-83921484
Sequence CAGGGTATATGGAAGGAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 415}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141421640 Original CRISPR CAGGGTATATGGAAGGAAGA TGG Exonic
900116762 1:1032433-1032455 CAGGGCACCTGGAAGGAAGGAGG + Intronic
900462033 1:2806149-2806171 CAAGGTCTGTTGAAGGAAGAAGG - Intergenic
900912945 1:5615023-5615045 CAGGGAATATAGCAGGATGAAGG + Intergenic
901856626 1:12048529-12048551 CAGAGAACTTGGAAGGAAGAAGG - Intergenic
902175852 1:14650149-14650171 GTGGGTATGTGGAAGGAAGTAGG + Intronic
902892551 1:19454942-19454964 CTTGGTAAAGGGAAGGAAGAGGG + Intronic
904011091 1:27391159-27391181 CAGGGAACATGGGAGGAGGAGGG - Intergenic
904894094 1:33801159-33801181 GAGGGGGCATGGAAGGAAGAGGG - Intronic
905324462 1:37140924-37140946 CAGGGGATAGGGAAGAAAGTGGG - Intergenic
905656176 1:39687338-39687360 CAGGGTATAGTCAAGGAAGCTGG + Intronic
905746619 1:40423690-40423712 CATGGTATAGGGAAAGAACAAGG - Intergenic
906147770 1:43570076-43570098 CAGGCTACAGGGAAGGAGGAGGG - Intronic
907907781 1:58799912-58799934 CAGGAAAGAAGGAAGGAAGAAGG - Intergenic
909296797 1:73960084-73960106 CAGGTAATATGGAAGGGAAAGGG - Intergenic
910317488 1:85902753-85902775 AAGGGTGTATGGATGGGAGAGGG + Intronic
912703908 1:111897954-111897976 CCGTGTTTATGGAAGGAAGGTGG - Intronic
913482087 1:119298518-119298540 CAGAGTATAGGCAAGGATGAGGG - Intergenic
914956436 1:152166933-152166955 CAGAGTATGGGGCAGGAAGATGG + Intergenic
916495860 1:165346011-165346033 CAGGGTATAGGGGAGGGAGAAGG + Intronic
916736720 1:167614129-167614151 GAGGGAAGAAGGAAGGAAGAAGG - Intergenic
917606796 1:176639541-176639563 CAGGGAAAATGGAAGAAAGACGG - Intronic
918037044 1:180883755-180883777 CAGGGTATGTGCAACGCAGAAGG - Intronic
919530479 1:198712683-198712705 TAATGTATATGAAAGGAAGAGGG + Intronic
920983615 1:210862902-210862924 CAGGGAATCTGTAGGGAAGAAGG - Intronic
921122982 1:212152867-212152889 AATGGTATTTGGAAGGAAGTTGG + Intergenic
921568838 1:216754163-216754185 CAGAATATTTGGAAGGAAGAAGG - Intronic
921755029 1:218845503-218845525 CAGGGAATAGGGAAGGAGGTAGG + Intergenic
922112601 1:222576287-222576309 CAGAGTATCTTGAAAGAAGAGGG + Intronic
924187252 1:241506326-241506348 CAAAGTATAGGGAAGGATGAGGG + Intronic
924202593 1:241675140-241675162 TAGGGAAGAAGGAAGGAAGAAGG - Intronic
924703156 1:246474710-246474732 CAAGGTTTATGGAAGGAAAAGGG + Intronic
1064126274 10:12663451-12663473 CAGGATATATGGGAAGAAGGTGG + Intronic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1065778387 10:29143593-29143615 CAGGGGATCTGGAAGGAGAATGG - Intergenic
1067256906 10:44650201-44650223 TAAGGAATAAGGAAGGAAGAAGG - Intergenic
1068092340 10:52448110-52448132 CAGGATATCTGGGAAGAAGAGGG - Intergenic
1068865317 10:61889151-61889173 CAGGATATATGGACAGAATAGGG - Intergenic
1069649817 10:70038025-70038047 CATGGTTCATGGAAGGAAGAAGG - Intergenic
1069824458 10:71246563-71246585 CTGGGTTGAGGGAAGGAAGAAGG + Intronic
1070821174 10:79355499-79355521 CAGGGTCTTAGGAAGGAGGAGGG + Intergenic
1071734780 10:88286186-88286208 CAGGAAATATGTGAGGAAGAAGG - Intronic
1072967676 10:99988393-99988415 CTGGGTACAGGAAAGGAAGAAGG + Intronic
1072968482 10:99995501-99995523 TAGTGTATATGGTAGGTAGAAGG - Intronic
1073173092 10:101529752-101529774 CAGGGTATATAACAGGGAGAGGG + Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073358081 10:102872852-102872874 CAGGATAGATGGCAGCAAGAAGG - Intronic
1073559710 10:104486467-104486489 CAGGGTAGATGGAAGGACAGGGG + Intergenic
1073616783 10:105004331-105004353 CAGGGTTTAAGGAAGCAACATGG + Intronic
1073770228 10:106727791-106727813 CAGGGTATGGGCAAGAAAGAAGG + Intronic
1074534141 10:114316391-114316413 GAGGGTATTTGGGAGTAAGAAGG - Intronic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075548329 10:123373128-123373150 CGGGTTATATTGGAGGAAGAGGG - Intergenic
1075859292 10:125661167-125661189 CGGGTGATGTGGAAGGAAGATGG + Intronic
1076899657 10:133331786-133331808 CATTTTATATGGAAGGCAGAGGG + Intronic
1077615178 11:3669099-3669121 CAGGTTATGTGGTAGGGAGAGGG + Intronic
1078035055 11:7794816-7794838 CTGGGTATGTGGAAGCAATAAGG + Intergenic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1078646012 11:13141951-13141973 CGGGGGAAATGGAAGGAAGCCGG + Intergenic
1079016895 11:16876489-16876511 CAGGGAACATGGACAGAAGATGG + Intronic
1079461407 11:20681932-20681954 AAGGGAAAATGGAAGGCAGAAGG - Intronic
1080862070 11:36158495-36158517 CATGGTAAGTGGAACGAAGAGGG - Intronic
1081983994 11:47288567-47288589 CAGGGTATGAGGATGGGAGATGG - Intronic
1082130187 11:48479116-48479138 TAGGGTTTATGGAAGAAGGAGGG - Intergenic
1082563713 11:54650025-54650047 TAGGGTTTATGGAAGAAGGAGGG - Intergenic
1083197734 11:61099097-61099119 CAGGGTCTCTGCAAAGAAGATGG - Intergenic
1083487629 11:62993465-62993487 CAGGGTCTCAGGCAGGAAGAGGG + Exonic
1083520483 11:63306247-63306269 CAGAGGCTAGGGAAGGAAGAAGG - Intronic
1084785710 11:71440584-71440606 GAGGGTAGATGGATGGATGATGG + Intronic
1085554207 11:77404667-77404689 CATTGTAACTGGAAGGAAGAAGG - Intronic
1088368069 11:109059787-109059809 CAGGGCATATGGGAGGATGGGGG + Intergenic
1088700811 11:112409596-112409618 AAGAGTAGCTGGAAGGAAGATGG - Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1090294113 11:125571071-125571093 CAGGGGATATGGCAGTAGGAAGG - Intronic
1091346712 11:134859229-134859251 GAGGATATGTGAAAGGAAGAAGG - Intergenic
1092203166 12:6599831-6599853 CAGTGGATGTGGTAGGAAGAAGG + Exonic
1092736696 12:11589485-11589507 CAGGAAAGAAGGAAGGAAGAAGG - Intergenic
1093339221 12:17950431-17950453 CTTGGTACAAGGAAGGAAGAAGG - Intergenic
1093411824 12:18877126-18877148 CAGGGCATAGGGATGGAGGAAGG + Intergenic
1093704893 12:22264021-22264043 GAGGGTATATAGAAAGAAAAGGG - Intronic
1094678252 12:32643406-32643428 CAGAGTATAAGGAAGGGAAATGG + Exonic
1094727325 12:33133686-33133708 CAGGCAAGAAGGAAGGAAGAAGG + Intergenic
1095475166 12:42579626-42579648 GAGGGCATATGGTAGGAAGAAGG + Intronic
1095523272 12:43094074-43094096 CAGGGACTTGGGAAGGAAGATGG + Intergenic
1095618661 12:44223191-44223213 CAGGGTGGAGGGTAGGAAGAGGG - Intronic
1096099613 12:48961832-48961854 TAGTGTATGTGGAAGGAAGAGGG - Intergenic
1097516176 12:60609425-60609447 CAGGGTAAATAGAAAGGAGATGG - Intergenic
1097723008 12:63044100-63044122 CAAGGTACAAGAAAGGAAGAAGG - Intergenic
1098978171 12:76926424-76926446 CGGGGTAAATGGAAGAAAAAGGG + Intergenic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1103159344 12:118714936-118714958 AAAGGTGTATGGAAGGGAGAGGG - Intergenic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1104064711 12:125297196-125297218 CAGGGTGGATGGGAGGAGGAGGG + Intronic
1104481413 12:129111207-129111229 CAGGGAACAGGGGAGGAAGAGGG + Intronic
1104609214 12:130214896-130214918 GAGAGCATCTGGAAGGAAGAGGG + Intergenic
1104619199 12:130298119-130298141 GAGGGTAGAGGGTAGGAAGAGGG - Intergenic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1107002376 13:35564026-35564048 GAGGGTAGAGGGAAGGAGGAAGG - Intronic
1107315471 13:39126972-39126994 CAGGATATATAGAAGCCAGATGG + Intergenic
1108248065 13:48537008-48537030 AAGGCTATATGGAGGGAATAGGG + Intergenic
1112157600 13:96834545-96834567 AAGGGAATATGTATGGAAGAAGG + Exonic
1112229135 13:97570064-97570086 CAGGCTTTATGGGAGGCAGATGG - Intergenic
1112234764 13:97625330-97625352 CAGGGTACATGGCAAGAAGGAGG - Intergenic
1112378415 13:98865565-98865587 TAGGGTATTTGGTAGCAAGACGG - Intronic
1112446761 13:99471574-99471596 CAGGAAAGAGGGAAGGAAGAGGG + Intergenic
1113072694 13:106436834-106436856 CAGAATGCATGGAAGGAAGATGG + Intergenic
1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1114258171 14:21019816-21019838 CAGGATTTGGGGAAGGAAGAAGG - Intronic
1115349624 14:32379792-32379814 CAGGCTAGATGGAAGCTAGATGG - Intronic
1115699332 14:35935034-35935056 CATGGTATATGAAAGAAAAAAGG - Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119706953 14:76788947-76788969 CTGGATACATGGAAGGAAGGGGG + Exonic
1120930007 14:89838878-89838900 CAGGGTATAGCTAAGGAAGCAGG + Intronic
1121481475 14:94279899-94279921 GAAGCCATATGGAAGGAAGAAGG - Intergenic
1121481609 14:94281751-94281773 CAGTGTATGTGGTGGGAAGAAGG + Exonic
1122459369 14:101882643-101882665 CAGGGCATTTGTAAGGCAGAAGG + Intronic
1123457480 15:20439167-20439189 CAGGGCACAGGGAAGGGAGACGG + Intergenic
1123457518 15:20439353-20439375 CAGGGTACAGGGAAGGGAGACGG + Intergenic
1123457545 15:20439477-20439499 CAGGGTACAGGGAAGGGAGACGG + Intergenic
1123660526 15:22560944-22560966 CAGGGTACAGGGAAGGGAGACGG - Intergenic
1123660553 15:22561068-22561090 CAGGGTACAGGGAAGGGAGACGG - Intergenic
1123660578 15:22561192-22561214 CAGGGCACAGGGAAGGGAGACGG - Intergenic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123992976 15:25696994-25697016 CAGGAAATATGGGAAGAAGAAGG + Intronic
1124157815 15:27243387-27243409 CAGGGGATGGGGAAGAAAGAAGG + Intronic
1124263638 15:28214378-28214400 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263650 15:28214440-28214462 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263662 15:28214502-28214524 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263689 15:28214624-28214646 CAGGGCACAGGGAAGGTAGACGG + Intronic
1126179670 15:45772959-45772981 CAGCGGATCTGGAAGGACGAAGG - Intergenic
1126358239 15:47818626-47818648 AAGTGTATATGGAAAGAGGAGGG - Intergenic
1126423198 15:48497748-48497770 CAGGGTAGATGGAAGAAAGAGGG - Intronic
1127290905 15:57570310-57570332 CAGAGAATATGGAAGGGAGAAGG + Intergenic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128613838 15:69094264-69094286 GAGGGAAAAAGGAAGGAAGAAGG + Intergenic
1129872914 15:78952425-78952447 CAGGGTTTCTGGAGAGAAGAGGG - Intergenic
1130297027 15:82654647-82654669 CAGGGTATGTGGAAATAGGAGGG - Intergenic
1131085682 15:89573924-89573946 TATGGTATTTGGAAAGAAGAAGG - Intergenic
1133204757 16:4226651-4226673 AAGGGTGAATGGAAGGATGATGG + Intronic
1133328862 16:4958838-4958860 CAGGGTGTCTGGGAGGAAAATGG + Intronic
1133629209 16:7603184-7603206 TAGAGTCTATGGAAGGAAGCAGG + Intronic
1133898244 16:9949492-9949514 TAGGGTAGATGGATGGATGACGG + Intronic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134351827 16:13444796-13444818 AAGGGAAGATGGAGGGAAGAGGG - Intergenic
1134821259 16:17249185-17249207 GAGGGTATATTGAAGGGAGCTGG + Intronic
1136580248 16:31147263-31147285 GAGGGTACATTGCAGGAAGATGG - Intronic
1136702006 16:32152813-32152835 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1136765660 16:32774647-32774669 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1136802439 16:33095731-33095753 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1137825555 16:51491479-51491501 CGGAGTCTATGGAAGGTAGAAGG - Intergenic
1140780256 16:78289455-78289477 CAGGGTAGTGGGAAGGAACAGGG + Intronic
1141036590 16:80631410-80631432 CAGGGTACATGGCAGGAGAAGGG - Intronic
1141421538 16:83921019-83921041 GAGGGTGGATAGAAGGAAGATGG + Exonic
1141421570 16:83921172-83921194 ATGGGTGGATGGAAGGAAGATGG + Exonic
1141421582 16:83921221-83921243 GAGGGTGGATGGAAGGAAGATGG + Exonic
1141421621 16:83921397-83921419 GAGGGTGGATGGAAGGAAGGAGG + Exonic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141946104 16:87311071-87311093 AAGGGGAGATGGGAGGAAGAAGG - Intronic
1203068048 16_KI270728v1_random:1036895-1036917 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1143709147 17:8721900-8721922 CAGGGTAGCTGGAATGAAGAGGG - Intergenic
1144371304 17:14594294-14594316 CAGGAGATATGGATAGAAGAGGG + Intergenic
1144379836 17:14683767-14683789 CAGGGAGTGAGGAAGGAAGAAGG - Intergenic
1145965529 17:28914043-28914065 CAGGATAGATAGAAGGAGGAAGG + Intronic
1147141620 17:38463602-38463624 CAGGGTATCTGGAAGGAGGGTGG + Intronic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148018379 17:44538421-44538443 TAGGATTTATGGAAGGAAGAGGG - Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148797251 17:50202973-50202995 CAGGCTATATCTAAGGAAGATGG + Intergenic
1150381877 17:64727265-64727287 CAGGGGTTATGGTAGGAGGAAGG + Intergenic
1151210994 17:72543593-72543615 CAGGGGACATGGAAGGGAGAGGG - Intergenic
1151920388 17:77150382-77150404 CAGGGTATCTGGAAGGGAGAGGG - Intronic
1153316083 18:3723786-3723808 GAGGGTGTAAGGTAGGAAGATGG + Intronic
1153343710 18:4003863-4003885 CAGGCTCTAAGGAAGGAAGATGG + Intronic
1154986384 18:21555249-21555271 CAGGGGTTAAGGTAGGAAGAAGG + Intronic
1157937842 18:51892852-51892874 AAGGGTATATGAAATGAATAGGG + Intergenic
1158021175 18:52843858-52843880 CAGGAAATATGTAGGGAAGAGGG + Intronic
1158343157 18:56488030-56488052 CAGGGTATCTGGAAGGATGTGGG - Intergenic
1159231519 18:65613319-65613341 CAGGGAGGAGGGAAGGAAGAAGG + Intergenic
1161352557 19:3801983-3802005 CGGGGCATAAGGAAGGAAGCGGG + Intronic
1161384723 19:3984927-3984949 GAAGGTATTTGGAAGGAAAAGGG + Intronic
1161632399 19:5364813-5364835 CAGGGGATGTGGAACGAGGATGG + Intergenic
1162414100 19:10524061-10524083 CAGGCTATGTGGAAAGAAAAGGG - Intergenic
1164173010 19:22742637-22742659 CAAGGTATTTAGAAGAAAGAGGG + Intergenic
1164291453 19:23872679-23872701 CAGGAGATATGCAAGGGAGAAGG - Intergenic
1164301690 19:23967737-23967759 CAGGAGATATGCAAGGGAGAAGG - Intergenic
1164729759 19:30494583-30494605 TAGGTTAGATGGAAGGAAGGAGG - Intronic
1165776922 19:38410089-38410111 CAGGGGACCTGGAAGGAGGAAGG + Exonic
1166088808 19:40494882-40494904 CAGGGTAACTGGAAGGGTGAAGG - Exonic
1166167764 19:41004216-41004238 GGGAGTATATGGGAGGAAGAAGG + Intronic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1166614461 19:44230684-44230706 GATGGAAAATGGAAGGAAGATGG - Intronic
1167387634 19:49173390-49173412 ATGGGTAAATGGATGGAAGATGG - Intronic
1167495060 19:49812819-49812841 CAGGTCATATGGAAAGAGGATGG - Intronic
1168143879 19:54408430-54408452 GAGGGGAAAAGGAAGGAAGAAGG + Intergenic
925325735 2:3020552-3020574 CAGCGTCTTTGAAAGGAAGAAGG + Intergenic
926056985 2:9779411-9779433 CAGAGTCTCCGGAAGGAAGATGG + Intergenic
926244660 2:11113776-11113798 GAGGGAAGAAGGAAGGAAGAAGG - Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
928250810 2:29677221-29677243 GAGGGGAGAAGGAAGGAAGAAGG - Intronic
928484807 2:31718809-31718831 CAGGTTATTTGGAGGAAAGAGGG - Intergenic
929865684 2:45715494-45715516 CTGGATAGATGGAAGCAAGAGGG - Intronic
930167635 2:48219101-48219123 CAAGGTATCTGGAAGCAGGATGG + Intergenic
930178711 2:48328374-48328396 TACAGTATATGGAAGGAAGTGGG - Intronic
931090459 2:58880549-58880571 CAGGGAAGGAGGAAGGAAGAAGG + Intergenic
931794576 2:65697045-65697067 CAGGGTATAGGTAAGCATGATGG - Intergenic
932593178 2:73079365-73079387 CAGGGTATAAGGAATGAAGTGGG - Intronic
933545882 2:83711388-83711410 CATGAGATAAGGAAGGAAGATGG - Intergenic
934495796 2:94796728-94796750 AAGGGTGTGTGGAAGGCAGAAGG - Intergenic
934649694 2:96083812-96083834 CAGGCACTAAGGAAGGAAGAGGG - Intergenic
935051117 2:99525914-99525936 CATGGTATAAGGCAGCAAGAAGG - Intergenic
936616928 2:114057332-114057354 AAGGGAAGAAGGAAGGAAGAAGG - Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939409397 2:141804696-141804718 CTGGGCATCTGGAAGGCAGATGG + Intronic
940497632 2:154453545-154453567 CAGGGGATAGGGAAGGCAGATGG - Exonic
940633231 2:156264661-156264683 TAAAGTATATGGAAGGAAAAGGG + Intergenic
941268956 2:163401266-163401288 GAGGGTAGAAGGAAGGAGGAGGG - Intergenic
941416149 2:165224102-165224124 CAGGGTATGAGGAAGAGAGATGG + Intergenic
941870948 2:170385104-170385126 CAGGGTGTATGGGGGGAGGAAGG + Intronic
946115548 2:217458820-217458842 CAGGCCACATGTAAGGAAGAGGG + Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
947375413 2:229490194-229490216 CAGGGAATATAGCAGAAAGAGGG + Intronic
947470027 2:230392868-230392890 CAGTGAATATTTAAGGAAGAGGG - Intronic
947502781 2:230683570-230683592 CAGGGTATAAGGAAGAGACATGG - Intergenic
1168973174 20:1944933-1944955 GAGGATAGATGGATGGAAGAAGG + Intergenic
1169739590 20:8877553-8877575 CAGGCTATGTGCAAGAAAGAGGG - Intronic
1169754898 20:9033351-9033373 GAGAGTACAAGGAAGGAAGAGGG - Intergenic
1170813281 20:19691957-19691979 CAGTGTCTATGGGAGGCAGAGGG - Intronic
1170934330 20:20796719-20796741 CAGGGTATGTGGAGGCAGGATGG + Intergenic
1172656645 20:36542031-36542053 CAGGGTGTAGGGATGGGAGATGG - Intronic
1174752167 20:53122567-53122589 CAAGGTGTTTGGAGGGAAGAGGG + Intronic
1174886449 20:54340303-54340325 AAGGGAGTATGGAAGAAAGAAGG - Intergenic
1175311970 20:58018511-58018533 CAGCAAATATGGAAGGGAGAGGG + Intergenic
1177764870 21:25446027-25446049 CAGGGTAGAGGGTGGGAAGAAGG + Intergenic
1178310534 21:31526268-31526290 CAGGGAAGATGGAAGGCAGCGGG + Intronic
1178570358 21:33730214-33730236 CAGGGTAAAGGGATAGAAGAGGG - Intronic
1180913252 22:19468166-19468188 CAAGTGATGTGGAAGGAAGAAGG + Intronic
1181049611 22:20232340-20232362 CTGGGTATAAGGAAGGAACTGGG - Intergenic
1181106318 22:20577841-20577863 CAGGATTTATGGAAAGAGGAAGG + Intronic
1182843334 22:33409955-33409977 TAGGGTATAGGTAATGAAGAGGG + Intronic
1183093310 22:35538357-35538379 CAGGTTATATGGGAGAGAGAGGG + Intergenic
1184734292 22:46388966-46388988 CAGGCTGCATGGAAGGGAGAGGG + Intronic
1184969215 22:48003221-48003243 CAGGGGACCTGGAAGGAAGGTGG + Intergenic
950643805 3:14365220-14365242 AAGGGTATCTGGTAGAAAGAAGG - Intergenic
951089520 3:18556043-18556065 CAGGGGATTTGGAGGAAAGATGG - Intergenic
951717202 3:25662944-25662966 GAGGGTATGTGAGAGGAAGAAGG - Intronic
952817036 3:37454444-37454466 CAGGGTAAATGGTAGGGAGTGGG + Intronic
953020338 3:39108989-39109011 CAGGGGATAGGGAAGGGAGCAGG + Intronic
954787413 3:53104105-53104127 CAGGGAAGAGGGAAGGAAGTTGG + Intronic
954798653 3:53174547-53174569 CAGAGTGTATGGCAGGGAGATGG - Intronic
955029070 3:55199103-55199125 CAGGCTATATGCAAGGCATAAGG + Intergenic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
956025515 3:64978807-64978829 CATGGTCTATGGGAGGAAGAGGG - Intergenic
956575825 3:70751955-70751977 CACGATATATTCAAGGAAGAAGG + Intergenic
956643374 3:71435217-71435239 CAGGAAAGAAGGAAGGAAGAAGG + Intronic
958728299 3:97932838-97932860 CAGTGGATCTGGAAAGAAGATGG - Intronic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959572477 3:107899755-107899777 CAAGGGAGATGGAAGGCAGATGG - Intergenic
959626334 3:108456372-108456394 CAGGGTGTATGGCAGGAGGCAGG - Intronic
959720531 3:109482148-109482170 TAGGGTTTATTGAAGGAGGAAGG + Intergenic
959733203 3:109628026-109628048 CAGGGTATATGGAAACCACAAGG + Intergenic
959784102 3:110272679-110272701 CAGGGTGTGGGGCAGGAAGAGGG - Intergenic
960259544 3:115550669-115550691 CAGAGTAAATGGAAAGCAGATGG + Intergenic
960878884 3:122325075-122325097 CATGGAATTTGGAAGAAAGAGGG - Intergenic
960936944 3:122910296-122910318 CAGGGTCTGTGGGTGGAAGAAGG + Exonic
961639042 3:128353462-128353484 CAGGTTATTTGGAAGGGAGGAGG - Intronic
962015392 3:131434274-131434296 AAGGATGGATGGAAGGAAGAAGG + Intergenic
963752085 3:149191342-149191364 TAGTGTATATGGGAGGAAGGAGG - Intronic
964198048 3:154087384-154087406 CTAGGTGTATGGAAGGATGATGG - Intergenic
964528225 3:157638798-157638820 CAGGGTATGTGGGAGGGGGAGGG - Intronic
964689399 3:159433075-159433097 CAGCGCACTTGGAAGGAAGAAGG + Intronic
964917787 3:161857160-161857182 CAGTCTATATGAAAAGAAGATGG + Intergenic
965160299 3:165124432-165124454 CAGGGAAGAGGGAAGAAAGAGGG + Intergenic
965971442 3:174561150-174561172 GAGGAAATATGGAAGTAAGAGGG + Intronic
967633231 3:191771603-191771625 TAGGGAATCTGGAAGGCAGAAGG - Intergenic
968817195 4:2828270-2828292 CAGGGAAAATGGAAGGATCAAGG - Intronic
969108974 4:4829462-4829484 CAGGGAAAATGCAGGGAAGAGGG - Intergenic
969232671 4:5842538-5842560 CAGGGAGTGTGGAAGGAGGAAGG - Intronic
969470337 4:7384102-7384124 CAGGGACTGTGGGAGGAAGAAGG - Intronic
970212399 4:13723338-13723360 CAGGGTTTATGGAAGGGACAAGG - Intergenic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
971189757 4:24416226-24416248 CAGGGTAGATGGGACTAAGAAGG + Intergenic
971748494 4:30615270-30615292 CAGGGTACATGGTAAAAAGAGGG + Intergenic
973979498 4:56296091-56296113 CAGGGTATGGGAGAGGAAGACGG - Intronic
976679153 4:87735548-87735570 CAAGCTACATGGAGGGAAGAGGG - Intergenic
977166703 4:93708765-93708787 CAGGAAAGAAGGAAGGAAGAAGG - Intronic
977955552 4:103021234-103021256 TAGGGTCCATGTAAGGAAGATGG + Intronic
979677845 4:123429196-123429218 TAGGGTAAGTGGAGGGAAGATGG + Intergenic
980240832 4:130172646-130172668 CAGGGTATAAGGTAGGAAGGAGG - Intergenic
980400454 4:132277327-132277349 AAGGGAAGAAGGAAGGAAGAAGG - Intergenic
980762735 4:137256941-137256963 CAGTATATCAGGAAGGAAGATGG + Intergenic
981124993 4:141095321-141095343 CAGGCAATATGACAGGAAGAAGG + Intronic
982418514 4:155165470-155165492 CAGGGTATATGGGAGAAATGGGG + Intergenic
984835321 4:184014249-184014271 AAGGGTATGTAGAAGGAAAAAGG + Intronic
984885048 4:184442455-184442477 CAGGGTCTTTTGAAGGCAGAAGG + Intronic
985280570 4:188282653-188282675 CCGGGGATAGGGAAGGAGGAAGG - Intergenic
986418169 5:7549330-7549352 CATGGCAAATGGAAGGGAGATGG + Intronic
986428037 5:7654233-7654255 CAGGGTTTCAGGAAGGAAGAAGG + Intronic
986431576 5:7686125-7686147 CATGGTTTATTGAAGGAACAGGG + Intronic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
987129213 5:14845256-14845278 CAGGACAGATGGAAGAAAGACGG - Intronic
988597467 5:32608035-32608057 CAAGGTATGGGGAAGGGAGATGG + Intergenic
989747139 5:44842766-44842788 CAGGAGAGATGGAAGGATGAAGG + Intergenic
990387360 5:55279219-55279241 CAGGGGATGTGGGAGAAAGAAGG + Intronic
990820152 5:59829887-59829909 CAGGGTATTTTAAAGAAAGAAGG - Intronic
993387623 5:87278869-87278891 CAGGGAATAAGGAAAGAGGAAGG - Intronic
993747871 5:91624118-91624140 GAGGGAAGAAGGAAGGAAGAGGG + Intergenic
993926720 5:93874507-93874529 CAAGGTATATGGATGGGAAAGGG - Intronic
994580928 5:101641027-101641049 CTGTGTTTATGGAAGGGAGAGGG - Intergenic
994749090 5:103716488-103716510 TAGGGGATATGGAAAGAAGGGGG - Intergenic
995235425 5:109824201-109824223 CAGGCTATATTTAAGGAAGCAGG - Intronic
995992893 5:118264106-118264128 GAGGGTAGAGGGTAGGAAGAGGG - Intergenic
996290263 5:121844402-121844424 TTGGGTCTTTGGAAGGAAGACGG - Intergenic
996782118 5:127198679-127198701 CAGGGAAAATGGAACCAAGATGG + Intergenic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
997805952 5:136918028-136918050 CATGGTCTAGGGAAGGAGGAAGG - Intergenic
998226658 5:140332220-140332242 TATGTTATATGGAAGCAAGATGG + Intergenic
998401865 5:141852547-141852569 GGGGGTTTCTGGAAGGAAGAGGG + Intergenic
998813217 5:145986888-145986910 CAGGGAAAAGGGAAGGAAGTAGG - Intronic
999092634 5:148950760-148950782 CAGAGTAGAGGGAAGGAAGGGGG - Intronic
999273013 5:150308786-150308808 CTGGATATATGGAAGGTAAATGG + Intronic
1001072802 5:168601391-168601413 CAGGGTATATTCTAGGAAAAGGG - Intergenic
1001128407 5:169042073-169042095 CAGGGCATAGGCAAGGAAAATGG + Intronic
1001378579 5:171286760-171286782 CAGGGTTTGTGGAAGTAAGGGGG - Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001919427 5:175588710-175588732 GAGGGAAGAAGGAAGGAAGAAGG + Intergenic
1003063901 6:2885874-2885896 AAGGGTTTTTGGAAGGAAGTGGG - Intergenic
1003683211 6:8276142-8276164 ATGGGTATATGGCGGGAAGAGGG + Intergenic
1004174236 6:13325118-13325140 CACGGTACATGGACGGGAGAGGG + Exonic
1004263985 6:14133139-14133161 CAGGGACTATGAAAGGAAGCAGG - Intronic
1004526476 6:16413294-16413316 CATGGTATATGGGAAGAACACGG - Intronic
1004635985 6:17468189-17468211 CAGGATAGATGGAAGGGTGAAGG - Intronic
1004740476 6:18455686-18455708 CATAGTATATGGAAAGAACATGG + Intronic
1005447746 6:25942033-25942055 AAGGGAATGTGCAAGGAAGAGGG + Intergenic
1005497282 6:26398806-26398828 CAGGGAAGATGGGAGGAAGGAGG - Intergenic
1006260842 6:32868468-32868490 CAGGGTATGAGGTTGGAAGAAGG + Intergenic
1006468789 6:34213691-34213713 CAGGGTTTAGGGATGGAGGAAGG - Intergenic
1006557868 6:34884399-34884421 TGGGGTATATGGAAGGGTGAAGG + Intronic
1006557872 6:34884418-34884440 AAGGGTATATGGAAGGATGAAGG + Intronic
1007085458 6:39141208-39141230 TAGGGGACATGGGAGGAAGAGGG + Intergenic
1007263771 6:40582197-40582219 CAGGAAACATGGAAGGAAGAGGG + Intronic
1007665793 6:43512308-43512330 CAGGATCCCTGGAAGGAAGATGG + Exonic
1007991111 6:46256956-46256978 CAGGGTCTATGGAATAAAGATGG + Intronic
1009554066 6:65139433-65139455 GAGGGTGAAGGGAAGGAAGAGGG + Intronic
1010789051 6:80043286-80043308 TAGGGTAGAGGGAAGGATGAAGG - Intergenic
1011741741 6:90368260-90368282 CAGGTTATATGGAAGGTGGTGGG - Intergenic
1012305046 6:97644936-97644958 CAGGTTGTATGGTAGAAAGAAGG - Intergenic
1012670803 6:102044736-102044758 CAGGTTAGATGTAGGGAAGAGGG - Intronic
1014332254 6:120083988-120084010 CAGGGTAAATGGAAGTAAAATGG + Intergenic
1015978999 6:138820079-138820101 CAGGGTTTCTGTCAGGAAGAAGG - Intronic
1016482598 6:144497897-144497919 CAGGATATAGTGAAAGAAGAGGG + Intronic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018961061 6:168448711-168448733 CAAGGCTTATGGTAGGAAGAGGG - Intronic
1019181471 6:170189679-170189701 CAAGTTAGATGGAAAGAAGATGG - Intergenic
1020342517 7:7127469-7127491 TTTGGTATATGGTAGGAAGAGGG + Intergenic
1020530141 7:9323016-9323038 CAGGGTATTTGGGAGGAATGTGG - Intergenic
1021513086 7:21455488-21455510 CAGGATATAGGAAAGTAAGAGGG - Intronic
1021550393 7:21865498-21865520 CAGGGGATGGGGAAGGAAAAAGG + Intronic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1022621251 7:31986728-31986750 CAGGGTCGATGGAAGGAGCATGG + Intronic
1023892113 7:44400363-44400385 CAGGTTATGTGGAAGGCAGCTGG + Intronic
1024160158 7:46665939-46665961 CAGGGGAAATGGTAGGAAGGCGG - Intergenic
1024883100 7:54111807-54111829 CAGGGAAAAGGGAAGGAAAAGGG + Intergenic
1026639055 7:72108608-72108630 CAGGGTGTATGGTAAGAACAAGG - Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1029658073 7:101940433-101940455 CAGGTGAGATGGAAGGAATAAGG + Intronic
1029901394 7:104044065-104044087 GAGGGTGGAGGGAAGGAAGAGGG + Intergenic
1030011464 7:105172355-105172377 CAGGGGAGTAGGAAGGAAGAAGG + Intronic
1031647740 7:124247460-124247482 GAGGGTAGAGGGAAGGAGGAGGG - Intergenic
1032653160 7:133900674-133900696 CAGGGGACAGGGAAGGAAAATGG + Intronic
1033067686 7:138171995-138172017 CCGGATATGTGGAAGCAAGAGGG + Intergenic
1034859154 7:154581420-154581442 CAGGGTGTGTGGGAGGAAGTGGG - Intronic
1035008033 7:155684373-155684395 CTGGGTAGATGGAAGAAAGCAGG - Intronic
1035424424 7:158758771-158758793 CAGGGTTTAAGGTAGGATGACGG + Intronic
1036064020 8:5357955-5357977 CCGGGTATACGGAAGTAAAATGG - Intergenic
1037745110 8:21637054-21637076 AAGGGTAAATGGAAGAATGAGGG - Intergenic
1037996743 8:23358077-23358099 GAGGTTATAAGGAATGAAGATGG + Intronic
1038757920 8:30359209-30359231 TTGGGTAATTGGAAGGAAGAGGG - Intergenic
1038909612 8:31948311-31948333 CCAGGTAAATGGAAGGAAAATGG + Intronic
1039060959 8:33571879-33571901 TAGGGTATCTGGACAGAAGAAGG - Intergenic
1039273327 8:35907078-35907100 AAGGGTATGTGTAAGGAACATGG - Intergenic
1039335004 8:36579111-36579133 GAGGGTAAAGGGCAGGAAGAGGG + Intergenic
1039383794 8:37112123-37112145 GAGGGTAAATGGCAGGAGGAGGG + Intergenic
1040562588 8:48537398-48537420 AAGGATATATGTTAGGAAGATGG - Intergenic
1040563055 8:48541504-48541526 CAGGGTACATGGATGGCACATGG - Intergenic
1040669053 8:49665041-49665063 TAGGGAATATGGAAGCAGGAGGG + Intergenic
1041482937 8:58343339-58343361 CCAGGTATATGAAAGGGAGAAGG + Intergenic
1041762706 8:61384288-61384310 CTGGACATATGGAAGCAAGATGG + Intronic
1041945264 8:63433698-63433720 CAGGGAATATGGAGAGCAGAGGG + Intergenic
1042328746 8:67555985-67556007 CATGGCAGATGGAAGCAAGATGG - Intronic
1043276613 8:78404231-78404253 CTAGGTATCTGGAAGAAAGAAGG - Intergenic
1043923385 8:86009618-86009640 CAGGGTAGAGGGTAGGAGGAGGG - Intronic
1044150320 8:88768751-88768773 CAGGGTATATGGCAGTTAAAAGG + Intergenic
1044472980 8:92593315-92593337 CAGAGCATATGGAAAGAAGTTGG - Intergenic
1044493550 8:92849283-92849305 CAGAGTCTGAGGAAGGAAGAAGG + Intergenic
1045388057 8:101690001-101690023 CAGGGTATGTTCAAGGCAGAGGG + Intronic
1047749200 8:127867214-127867236 CAGGCTGTCAGGAAGGAAGAAGG + Intergenic
1048380084 8:133857867-133857889 CAGGGAAGATGGTATGAAGAAGG - Intergenic
1048983370 8:139715316-139715338 CAGGGCATCAGGGAGGAAGAGGG + Intergenic
1049371953 8:142272225-142272247 ATGGGTAGATGGAAGGAGGAAGG - Intronic
1049474885 8:142792482-142792504 AAGTGTAGATGGAAGGAGGATGG - Intergenic
1050242318 9:3649907-3649929 CAGAGTACAGGAAAGGAAGATGG + Intergenic
1050366295 9:4876831-4876853 CAGTGTAGATGGGAGGTAGAGGG + Intronic
1050493307 9:6212943-6212965 CAGGGTAGATGCAAGGTATATGG - Intergenic
1051334746 9:16055569-16055591 CATAGTATATTGCAGGAAGAAGG + Intronic
1052764687 9:32629377-32629399 CAGGGGAAATGGTAGGAAAATGG - Intergenic
1053570270 9:39297124-39297146 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1053807965 9:41822482-41822504 CAGATTATATGGGAAGAAGAGGG - Intergenic
1053836224 9:42138079-42138101 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054091892 9:60856134-60856156 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054113306 9:61131724-61131746 GAGGGTAAAGGGAGGGAAGACGG + Intergenic
1054126879 9:61321882-61321904 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054594394 9:67050445-67050467 GAGGGTAAAGGGAGGGAAGACGG - Intergenic
1054622627 9:67364946-67364968 CAGATTATATGGGAAGAAGAGGG + Intergenic
1055379702 9:75692782-75692804 CAGGGAATACAGAAAGAAGATGG - Intergenic
1056480057 9:86993837-86993859 CAGGGTATATACCAAGAAGAGGG - Intergenic
1056548483 9:87632790-87632812 CAGTGTATATGTAGGGATGAAGG + Intronic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1058073556 9:100626970-100626992 CTGGGTACAGGGTAGGAAGAGGG - Intergenic
1058606725 9:106731024-106731046 CAGGGTATTGGGAAGGAGCAGGG - Intergenic
1059718678 9:116937294-116937316 CAGGGAATAAGGAAGGAGGTGGG - Intronic
1059747527 9:117217478-117217500 AAGGATACAAGGAAGGAAGAAGG - Intronic
1059767510 9:117397539-117397561 CATGGTTTATGGAAGACAGATGG + Intronic
1059871432 9:118582314-118582336 CATGGTATATGGTAGGTATAGGG - Intergenic
1059901899 9:118936804-118936826 CAGGGTGGATGGTGGGAAGAGGG - Intergenic
1060039073 9:120284231-120284253 CAGGGTATATGGAAGGGACAGGG + Intergenic
1061595200 9:131624473-131624495 CAGGGTCTATAGAGGGGAGAAGG - Intronic
1061635492 9:131905849-131905871 CTGGGTAGATGGGAGGAAGAAGG - Intronic
1062257521 9:135635069-135635091 AAGGATAGAAGGAAGGAAGAAGG - Intronic
1185496960 X:561969-561991 CAGAGAATATGGTAGAAAGATGG - Intergenic
1186398554 X:9235122-9235144 CAGCCTTCATGGAAGGAAGAAGG - Intergenic
1186697691 X:12054530-12054552 TAAGTTATATGGAAGGAAAATGG - Intergenic
1187199495 X:17121242-17121264 CAGGGTATTTAGGAGGAAGTTGG - Intronic
1188472170 X:30553226-30553248 CAGGGAATCTGGAAGGCAAAGGG + Intergenic
1188509677 X:30921845-30921867 GAGAGTATATGGAAGGGAGAGGG - Intronic
1189746472 X:44173540-44173562 CAGGGCATATTGGAGGGAGAGGG + Intronic
1190129626 X:47735112-47735134 TAGGGTATATGGATATAAGAGGG + Intergenic
1190827233 X:54028790-54028812 CAGGGTATAGTGGAGGGAGAGGG - Intronic
1192291460 X:69800208-69800230 AAGGGTATATGGGTGGAAGCGGG + Intronic
1192430337 X:71107457-71107479 GAGGGTAGATGGAAAGAGGAAGG + Exonic
1192478555 X:71464984-71465006 CAGGGGAAATGGTAGGAAAATGG + Exonic
1192538634 X:71949819-71949841 CTTGGTATGTGGAAGGCAGAGGG - Intergenic
1193005397 X:76612797-76612819 AAGGGTAAAGGGGAGGAAGACGG + Intergenic
1195667064 X:107441086-107441108 TAGGGTATGGGCAAGGAAGAAGG + Intergenic
1196111496 X:111951739-111951761 CAGGGTATACGAAAGTTAGAAGG + Intronic
1199388161 X:147247481-147247503 CAGATAACATGGAAGGAAGAAGG + Intergenic
1199628678 X:149761736-149761758 CAGGATCAATGGGAGGAAGAGGG - Intergenic
1199837146 X:151602768-151602790 TAGGGTATATGGTAAGAAGTTGG - Intronic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1201709058 Y:16969442-16969464 CAGGTTTTATGGAGGTAAGATGG + Intergenic