ID: 1141422193

View in Genome Browser
Species Human (GRCh38)
Location 16:83924572-83924594
Sequence CTGTCTGAGCAGCAGGAGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 331}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141422193_1141422199 22 Left 1141422193 16:83924572-83924594 CCTCACTCCTGCTGCTCAGACAG 0: 1
1: 1
2: 3
3: 38
4: 331
Right 1141422199 16:83924617-83924639 GCCTCCTTGAGCACTTTCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141422193 Original CRISPR CTGTCTGAGCAGCAGGAGTG AGG (reversed) Exonic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900457924 1:2786325-2786347 CTGTCTGAGCACTAGGAGGTTGG + Intronic
900597594 1:3489582-3489604 CTACCTGAGCATCAGCAGTGGGG - Intergenic
900900403 1:5512100-5512122 CTGCCTGAATGGCAGGAGTGGGG - Intergenic
900974945 1:6011158-6011180 CTGAGGGAGCAGCAGGAGTGAGG + Intronic
901195598 1:7438262-7438284 CTGTCCGAGCGGCAGGTTTGCGG + Intronic
902245343 1:15117233-15117255 CTGTCCAAGCAGCCCGAGTGTGG + Exonic
902283546 1:15391584-15391606 CTTTCTGCAAAGCAGGAGTGTGG - Intronic
902669145 1:17960519-17960541 CTGTGTGTGCAGAAGGAATGTGG - Intergenic
903226636 1:21897456-21897478 CTGTGGGAGCAGTAGGGGTGGGG - Intronic
903695181 1:25201153-25201175 CTGTCAGAGGAGCTGCAGTGGGG - Intergenic
905289282 1:36910550-36910572 CTCTCTCAGCAGCAGTGGTGGGG + Intronic
905881027 1:41463856-41463878 CTGTATGAGGAGCTGAAGTGGGG + Intergenic
905935543 1:41821250-41821272 CTGCCTGAGAAGACGGAGTGAGG - Intronic
906192832 1:43909212-43909234 CTGACTGAGAGGCAGGAGTTTGG - Intronic
907824838 1:58005545-58005567 CTGTCTGGGTATCAGGACTGAGG - Intronic
908067270 1:60420461-60420483 GTGTCTCAGCAGCAGGAAGGTGG + Intergenic
908920401 1:69184113-69184135 CTGTGTGAGGAGCAGAATTGAGG + Intergenic
910342462 1:86203359-86203381 CTGGCAATGCAGCAGGAGTGGGG - Intergenic
911253222 1:95604129-95604151 CTCTCTGAGGAGCAGGATGGCGG + Intergenic
911396318 1:97315200-97315222 CTGGCCCAGCTGCAGGAGTGTGG + Intronic
914492505 1:148161074-148161096 GGGTCAGAGCAGCTGGAGTGTGG + Intergenic
916830248 1:168483565-168483587 CTGTCTAAGCAGCTTGAGTCTGG + Intergenic
917681671 1:177374324-177374346 CTGTCTAAACAGCAGGATTTTGG + Intergenic
918071073 1:181133742-181133764 CTGCCTGAGCAGCAGGGGCCTGG - Intergenic
919342293 1:196327693-196327715 CAGCCTGGGCGGCAGGAGTGAGG - Intronic
919484464 1:198129878-198129900 CTGTCTCAGCAAGAGGAATGAGG + Intergenic
919664923 1:200282753-200282775 CTTTCTCAGCAGCAGGAGGGAGG + Intergenic
919790670 1:201288827-201288849 CTGAAAGAGCAGCAGGATTGTGG + Intronic
919823053 1:201484867-201484889 CTGGCTGGGCACTAGGAGTGGGG - Intronic
920275213 1:204799416-204799438 CTGTCTGCGCAGCATTAGTTGGG - Intergenic
920827039 1:209431935-209431957 CTGTCTGTGCAGCAGGTGCAAGG + Intergenic
922762959 1:228143734-228143756 CTGGGTGAGCAGCAGGAGCCAGG + Intronic
922806700 1:228394049-228394071 ATGTCTGTTCAGCAGGTGTGTGG - Exonic
922818749 1:228470029-228470051 CTCCCTGAGCAGCAGGTTTGGGG + Intergenic
923425578 1:233865643-233865665 CTGGCTGATTAGCTGGAGTGGGG - Intergenic
1062854160 10:771292-771314 CTGTCACACCCGCAGGAGTGAGG + Intergenic
1063025693 10:2177022-2177044 CTGTCGGAGCAGAAGGTCTGGGG - Intergenic
1063040778 10:2335181-2335203 CTTTCTGAGAAGCTGAAGTGTGG - Intergenic
1063366891 10:5496482-5496504 CTGACTGAGCAGGAGGCCTGCGG - Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064634028 10:17345529-17345551 CTGTTTGAGAAGCAGGAAGGAGG + Intronic
1064717065 10:18187193-18187215 GAGTCTGGGCAGCAGGAGTGGGG + Intronic
1065260088 10:23914861-23914883 CTGCCTGTGGAGCAGGACTGTGG + Intronic
1066256099 10:33680139-33680161 CAGTCTGAGCATCAGCTGTGGGG + Intergenic
1067686741 10:48470386-48470408 CTGTCCCATCAGCAGGGGTGGGG + Intronic
1067779714 10:49190905-49190927 ATGTCAGAGCTGCCGGAGTGGGG - Intergenic
1069724244 10:70567160-70567182 ATGGCAGAGCAGCAGGAGTAAGG - Exonic
1070554412 10:77516800-77516822 CTGTGTGAGCGGCTGGTGTGGGG + Intronic
1070820094 10:79349366-79349388 CTCACTGGGCACCAGGAGTGGGG - Intronic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1073304373 10:102491585-102491607 GTGTTGGAGCAGCAGGACTGTGG - Intronic
1073317716 10:102594476-102594498 ATGGCTCAGCTGCAGGAGTGAGG + Intronic
1074857459 10:117483850-117483872 CAGTCAGGGCAGCAGGAGCGTGG - Intergenic
1076361863 10:129895224-129895246 CTGCCTCACCAGCAGGAGTTTGG + Intronic
1076684373 10:132190515-132190537 AGGTCTGAGCAGCAGCTGTGGGG + Intronic
1076841056 10:133045445-133045467 TTTTCTGAGCAGCAGGAAGGTGG - Intergenic
1077184594 11:1230517-1230539 CTGGCTGAGCTGCGGAAGTGCGG + Exonic
1078723827 11:13909666-13909688 TTCTCTGAGCATCAGGAATGTGG - Intergenic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1083627438 11:64078797-64078819 CTCTCTGAGCAGGGGGTGTGGGG + Intronic
1083954431 11:65975756-65975778 CTGTCTGGGCTGCAGGGTTGAGG + Intronic
1084266936 11:68010024-68010046 CAGCCTGAGGAGGAGGAGTGGGG - Intronic
1084724769 11:70934370-70934392 CGGCCTGAGAAGCAGGAGGGAGG - Intronic
1084727700 11:70952756-70952778 GGGCCTGAGCAGCAGAAGTGTGG + Intronic
1084745246 11:71165977-71165999 CTGTCTGTGCAGCACGCGGGAGG - Intronic
1085892864 11:80601838-80601860 CTGTCTGTGCAGAAGTACTGTGG - Intergenic
1087000883 11:93419239-93419261 GGGTCTGAGCAGTAGCAGTGTGG - Intronic
1087159277 11:94933375-94933397 CACTCTGAGCAGCAGCAGTTTGG - Intergenic
1088186747 11:107178703-107178725 CTGTCTGAGCTACTGGACTGGGG + Intergenic
1089920305 11:122203251-122203273 CTGTGTGAGTTGCAGGACTGAGG + Intergenic
1092269325 12:7010443-7010465 CAGCCTGGGCAACAGGAGTGAGG - Intronic
1092445693 12:8554860-8554882 GTGCCTGAGCAGGAGGAGTAAGG + Intergenic
1094289675 12:28833154-28833176 GTGACTGTGCAGCAGGGGTGAGG - Intergenic
1096999090 12:55861293-55861315 CTGTCTGCCAAGCTGGAGTGCGG + Intergenic
1097156434 12:57015608-57015630 CTGTCTGGACAGCTGTAGTGAGG - Intronic
1097633120 12:62088439-62088461 CTGTCTGAGCAGAAGGACCGGGG - Intronic
1097670701 12:62534038-62534060 CTGTGTGACCAGTTGGAGTGAGG - Intronic
1099398584 12:82172860-82172882 CTCTCTGAGCAGCAGGACCAAGG + Intergenic
1100865329 12:98851538-98851560 ATGTGTGAGTAGCAGGACTGGGG + Intronic
1101254786 12:102966264-102966286 CTGTCTGGTCTTCAGGAGTGGGG - Intergenic
1101529033 12:105557704-105557726 CACTCAGAGCAGCAGGAGTGTGG - Intergenic
1101758178 12:107637905-107637927 CAGTCTGGGAAGCAGGAATGGGG + Intronic
1103591026 12:121992604-121992626 CAGCCTGGGCAACAGGAGTGAGG - Intronic
1103627050 12:122227243-122227265 CTGTCTGATGAGCTGGTGTGGGG - Intronic
1104439350 12:128782166-128782188 CGGCCTCAGGAGCAGGAGTGAGG - Intergenic
1105015733 12:132785948-132785970 CTCACTGAGAAGCAGGAGTGAGG - Intronic
1105543922 13:21338269-21338291 CTGTTTGGGCAGCAGTAGCGGGG + Intergenic
1106716054 13:32389391-32389413 CTCTCAGAGCATCAGGACTGAGG - Intronic
1107017781 13:35721519-35721541 GGGGCTGAGCAGCAAGAGTGGGG + Intergenic
1108270833 13:48757869-48757891 GTGTCTGGGGAGAAGGAGTGAGG - Intergenic
1108977389 13:56464410-56464432 TTGTGTATGCAGCAGGAGTGGGG - Intergenic
1112025973 13:95411463-95411485 CTGTCTGAGCATAAGGTGGGGGG + Intergenic
1112323884 13:98430588-98430610 CTGTCTGAGCAGACGGGGCGAGG + Intronic
1112438135 13:99406150-99406172 CTGTCTGAACCGCCGGAGTGTGG + Intergenic
1113029789 13:105980528-105980550 CTGTCAGAGTAGCTGGAGAGGGG - Intergenic
1113708302 13:112447906-112447928 GGGGCTGAGGAGCAGGAGTGGGG + Intergenic
1114567433 14:23643174-23643196 CTGGCTCAGCAGCAGGGCTGGGG - Exonic
1117939989 14:60952918-60952940 ATGTCAGAGTAGTAGGAGTGTGG + Intronic
1118314373 14:64716729-64716751 AGTTCAGAGCAGCAGGAGTGTGG + Intronic
1119195794 14:72715846-72715868 CTGTCAGCGCTGCAGGGGTGGGG - Intronic
1119679508 14:76581677-76581699 CTGGCTGAAGAGCAGCAGTGTGG + Intergenic
1119731410 14:76953607-76953629 CTGCCTGGGCAGCGGGAGAGTGG - Intergenic
1121095508 14:91215601-91215623 CTGGATGAGCAGCAGGCCTGAGG + Intronic
1121466977 14:94122127-94122149 CTTTAATAGCAGCAGGAGTGGGG - Intergenic
1121518714 14:94571033-94571055 CTGTCAGGGCTGCAGGAATGAGG - Intronic
1122386281 14:101350476-101350498 TTTTCTGAGCAGCAGGAGGGTGG - Intergenic
1123147471 14:106146889-106146911 CTGTCTCAGGAGCAGGGGTGAGG + Intergenic
1125587473 15:40831020-40831042 CTTCCTGAGCAGGAGGAGGGGGG + Intergenic
1129673890 15:77622077-77622099 CTGATTGGGCAGCAGGAGAGAGG + Intronic
1130176390 15:81575865-81575887 CAATCAGAGCAGCAGGAATGAGG + Intergenic
1130876075 15:88015650-88015672 CTGTCTCCCCAGCTGGAGTGTGG + Intronic
1132343096 15:101090307-101090329 CTGTCTGTGCAGCTGGATCGTGG + Intergenic
1132579432 16:678307-678329 CGGTCTGTGCAGCAGGTGTGGGG - Intronic
1132821911 16:1877503-1877525 CTGCCAGAGCCGCAGGAGGGTGG - Intronic
1133311534 16:4849915-4849937 CAGCCTGGGCAACAGGAGTGAGG + Intronic
1133528909 16:6633968-6633990 CAGTCTGGACAGCAGTAGTGCGG - Intronic
1135828135 16:25748452-25748474 CTCTCTGAGCTGCAGGTGTGGGG - Intronic
1136691268 16:32032553-32032575 CTGTCTCAGGAGCGGGGGTGAGG - Intergenic
1136791856 16:32976118-32976140 CTGTCTCAGGAGCGGGGGTGAGG - Intergenic
1136877961 16:33877790-33877812 CTGTCTCAGGAGCGGGGGTGAGG + Intergenic
1137650386 16:50114842-50114864 CTGCCTAAGGGGCAGGAGTGTGG - Intergenic
1138443218 16:57047359-57047381 CTGTCAGGGCAGGAGGATTGGGG + Intronic
1138549727 16:57740792-57740814 CAGACTGAGCAGCTGGGGTGGGG - Intronic
1138599735 16:58047353-58047375 CACTCTGAGCAGCATGTGTGGGG - Intergenic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1139832481 16:69811194-69811216 CTGGGAGAGCTGCAGGAGTGGGG - Intronic
1140093048 16:71852762-71852784 CGGTCAGCGCAGCAGGAGGGTGG - Exonic
1140919044 16:79519971-79519993 CTGTCTGTGCAGGTGGAGTTGGG + Intergenic
1141422193 16:83924572-83924594 CTGTCTGAGCAGCAGGAGTGAGG - Exonic
1141554230 16:84826564-84826586 CTGTGTGGGCAGCAGGCCTGGGG - Intronic
1141815878 16:86408987-86409009 CTGGCTGCTCAGCACGAGTGAGG - Intergenic
1142137889 16:88459944-88459966 CTATGTGAGCAGCAGGGTTGAGG - Intronic
1142205208 16:88779677-88779699 CTGTGTGTGCAGCATGAGGGAGG + Intronic
1203094068 16_KI270728v1_random:1237582-1237604 CTGTCTCAGGAGCGGGGGTGAGG - Intergenic
1143017081 17:3896632-3896654 CTGTCTGAACAGAAGGTCTGGGG - Exonic
1143118610 17:4594050-4594072 AGGTCTGAGCAGGGGGAGTGAGG + Intronic
1143237993 17:5419668-5419690 CGGGCTGAGCAACTGGAGTGAGG - Exonic
1144767599 17:17741036-17741058 CCGTCAGAGCATCCGGAGTGTGG + Intronic
1145404271 17:22571564-22571586 GTTGGTGAGCAGCAGGAGTGGGG + Intergenic
1146017655 17:29246873-29246895 CAGGCTGAGCAGCAGGAGCTGGG + Exonic
1146381767 17:32335391-32335413 CTATCTGAGCAGCTGGTTTGAGG - Exonic
1146658178 17:34647653-34647675 CTGACTGAGGAGTGGGAGTGGGG - Intergenic
1148821607 17:50363364-50363386 CTGCCAGAGCAGCAGGGGTGGGG - Intergenic
1150267068 17:63838542-63838564 CAGGCTGAGCAGCAGGAAAGTGG + Intronic
1151226821 17:72654199-72654221 CTGGCAGAGCAGCAGAAGAGGGG - Intronic
1151360383 17:73585093-73585115 GTGTCTGAGCAGCCTCAGTGAGG - Intronic
1152224335 17:79085769-79085791 CTGTTTGTCCAGCTGGAGTGGGG + Intronic
1152584778 17:81184015-81184037 TTGTCGCAGCAGCAAGAGTGAGG + Intergenic
1152727053 17:81952666-81952688 CTGTCTGAGCTGGTGGACTGAGG + Exonic
1153626833 18:7029267-7029289 TTGTCTGAGGACCAGCAGTGTGG - Intronic
1153757871 18:8301972-8301994 CTGCCGGAGCAGCGGGAGTGGGG + Intronic
1155384379 18:25261251-25261273 CTGTCTGATTAGCAGGAGCTAGG + Intronic
1157215914 18:45783315-45783337 CTGAGTGAGGAGTAGGAGTGGGG - Intergenic
1157776934 18:50403202-50403224 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1159061487 18:63519224-63519246 CTCTGTGAGCACCAGGTGTGTGG + Intergenic
1160588566 18:79927144-79927166 CTGCCTGCTCAGCTGGAGTGGGG - Intronic
1160739541 19:679690-679712 CTGTCTGAGCAGCGGGGCTGCGG + Intronic
1161043276 19:2121375-2121397 CTGTCTCAGGAGCAGGTGTTGGG - Intronic
1161131997 19:2595893-2595915 CTGTGTGAGCAGCACCTGTGTGG + Intronic
1161132290 19:2598057-2598079 CTGTGTGAGCAGCACCTGTGTGG + Intronic
1161724785 19:5922464-5922486 CGGCCTGAGGAGCAGGAATGGGG + Intronic
1161889136 19:7021421-7021443 CTGTCTGTGCCTCAGGAGTGGGG - Intergenic
1161892316 19:7049328-7049350 CTGTCTGTGCCTCAGGAGTGGGG + Exonic
1162198744 19:9006244-9006266 AGCTCTGAGCTGCAGGAGTGAGG + Intergenic
1162733697 19:12734254-12734276 CTGTCTTGGCAGCGGGAGTCGGG - Intronic
1162734640 19:12739544-12739566 CTCTCTGAGCAGCTGGGATGGGG + Intronic
1164063541 19:21695167-21695189 CTCTCTCAGCAGGAGGAGAGGGG + Intergenic
1164572370 19:29383694-29383716 CTGTCTGAGCAGTTTGAGTTGGG - Intergenic
1164574680 19:29398829-29398851 CTGTCTGGGCAGTGGGATTGGGG - Intergenic
1164695638 19:30241579-30241601 CTGTCTAAGGAGCAGCAGTGTGG + Intronic
1165272772 19:34724775-34724797 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1165417230 19:35702302-35702324 CTCGCTGAGGAGCTGGAGTGGGG - Intergenic
1165907143 19:39200920-39200942 CTGTCTGAGCCCCATGAGGGCGG + Exonic
1166315715 19:41988374-41988396 CTGTCTGAGGAACAGGAGTTTGG + Exonic
1166841230 19:45698524-45698546 CTGTGGGAGCAGCAGGGGGGTGG - Intronic
1167156031 19:47739784-47739806 CTGGCTGGGCAGCTGGAGTTGGG + Intronic
1167676906 19:50892922-50892944 CTATCTGAGAGGCAGGAGTAGGG + Intergenic
1167765246 19:51478477-51478499 CACTCTGACCAGCAGGGGTGGGG - Intergenic
1168250483 19:55138696-55138718 CAGGCTGAGCATCTGGAGTGAGG - Intronic
925165760 2:1714614-1714636 CTGTCTCTGCAGCAGGAATGCGG + Intronic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
926741485 2:16114953-16114975 ATGTCAGAGCAGCTGGAGGGGGG - Intergenic
926765379 2:16319095-16319117 CTTTCTGAGCAGCAGGCTGGAGG + Intergenic
927159435 2:20243291-20243313 CTGGCAGAGCAGCAGTAGAGAGG - Intergenic
927199708 2:20570790-20570812 CTCTCTGAGCTGGAGGAGTTTGG + Intronic
927277238 2:21272427-21272449 CTGTCTGAGCAACAGGAGTCAGG + Intergenic
928262257 2:29778571-29778593 GTGTGTGTGCAGCAGGAGTGAGG + Intronic
928437098 2:31261760-31261782 CTGGCTGAGCAGCCTGAGTATGG + Intronic
928649469 2:33389415-33389437 CTTTCTGACCAGCAGGTCTGGGG - Intronic
929749456 2:44694662-44694684 CTGTCTGTGTAGCAAGAGTGAGG - Intronic
930196663 2:48517409-48517431 TTGACTGAGCAGGAGGATTGAGG + Intergenic
932454113 2:71835172-71835194 CTCCATGATCAGCAGGAGTGAGG + Intergenic
932892971 2:75611933-75611955 CTGTCCCAGCAGCAGTAGGGAGG - Intergenic
936902859 2:117503803-117503825 GTGTCTGAGCAGCAGCAAAGTGG + Intergenic
938406486 2:131035779-131035801 CAGTTTGTGCAGCAGGGGTGGGG - Intronic
940740477 2:157502225-157502247 CTGTATAAGAAGCATGAGTGGGG + Intergenic
942126174 2:172827845-172827867 ATGTCTGAGCACCTGGAGTGAGG - Intronic
942277173 2:174331793-174331815 CTGACTGAGCAGCGAAAGTGGGG - Intergenic
942319796 2:174726275-174726297 CTGCCCCAGCAGCAGGAGTGAGG - Intergenic
944606810 2:201359082-201359104 CTGACTGAGGAGCAGCAGTGGGG + Intergenic
944667478 2:201969523-201969545 GTGTGTGATCAGCAGGATTGTGG - Intergenic
947057194 2:226118648-226118670 GTGTCAGAACAGCAGGACTGGGG - Intergenic
947556634 2:231099120-231099142 CTGTCTGAGCGGAAAGATTGGGG + Intronic
947633095 2:231666276-231666298 CTGCATGTGCAGCAGGAGGGAGG - Intergenic
947999537 2:234556334-234556356 GTGTCTGGGAGGCAGGAGTGAGG - Intergenic
948259302 2:236591042-236591064 CTGTCTGAGCAGGAGGCAGGAGG - Intergenic
948786074 2:240353623-240353645 CTGTTTGAGCAGCATGCGGGAGG - Intergenic
1168896834 20:1329336-1329358 CCGTCTGAACAGCAGCTGTGAGG - Intronic
1169268272 20:4180871-4180893 CTGTCTCCCCAGCTGGAGTGAGG + Intronic
1169415428 20:5412082-5412104 CTGTCTGGGAAGTGGGAGTGGGG - Intergenic
1171218029 20:23366250-23366272 GTTTCTGAGCTGCAGGTGTGTGG + Intronic
1172027039 20:31955579-31955601 TTGTGTGAGCAGCAGCAGGGAGG - Intergenic
1172278913 20:33696895-33696917 CTATCTGGGCAGCACGAGAGTGG + Intergenic
1173150507 20:40562898-40562920 CTCTCTGAGCAGCTGCAGGGAGG + Intergenic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1174042981 20:47713034-47713056 CTGTCTGGGGGGCAGGGGTGGGG + Intronic
1175417319 20:58810378-58810400 ATGGCTGAGCAGCAGTGGTGGGG + Intergenic
1175564027 20:59958632-59958654 CTGGCTGAGAAGGAGGTGTGTGG + Exonic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1175915894 20:62425609-62425631 CTGTCTGAGCAGGAGGCATCCGG + Intronic
1176122126 20:63458660-63458682 CTGTCTGAGCAGAGGATGTGGGG - Intronic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1176723766 21:10413684-10413706 CGGCCTGAGCGGTAGGAGTGGGG + Intergenic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1178969137 21:37155694-37155716 CTGGCTGTTCATCAGGAGTGGGG + Intronic
1180094985 21:45552292-45552314 CAGCCTGAGCAGCAGGGGTCAGG + Intergenic
1180167306 21:46036767-46036789 CTGGGTGAGCAGCTGGAGCGAGG + Intergenic
1180181863 21:46121664-46121686 CTGCCTGAGGAGCAGGACAGGGG + Intronic
1180917229 22:19497697-19497719 CAGGCTGAGCAGCAGGAGTGGGG - Intronic
1181797631 22:25321407-25321429 CTCTCTGAGAAGAAGGTGTGGGG + Intergenic
1182443956 22:30379692-30379714 CTGGGTGAGCACCAGGGGTGGGG - Exonic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1182929423 22:34158508-34158530 TTGTCTGAGTAGGAGGAGTTAGG - Intergenic
1183002621 22:34874371-34874393 CTGAATGAGCAGCAGGATTCAGG + Intergenic
1183453326 22:37907978-37908000 TTGTTTGAGGGGCAGGAGTGAGG + Intronic
1183717746 22:39543751-39543773 CTTTCTGAGCAGGAGGAGTGGGG - Intergenic
1184620769 22:45674512-45674534 CTCTCAGAGGAGCAGGAGTCTGG - Intronic
1184973058 22:48041190-48041212 CTGTCCCAGCAGCAGAAGAGGGG - Intergenic
950094372 3:10320273-10320295 GTGTCTCAGCAGCAGGTTTGAGG - Intronic
952419567 3:33118913-33118935 CTGTGAGAGCAGCAGGGCTGCGG - Intronic
952427949 3:33194378-33194400 CTATCTGAGCAGCAGGCAAGAGG + Intronic
952809876 3:37392246-37392268 ATGTTTGAGCATCAGAAGTGTGG + Intronic
953054990 3:39380973-39380995 CTGTCAGAGCAGGAGGAGGTGGG - Intergenic
953176164 3:40554504-40554526 CTGTCTCCCCAGCTGGAGTGTGG + Intronic
953203355 3:40797839-40797861 GTTTCTGAGTAGCAGGAGGGTGG + Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
954317747 3:49810476-49810498 CGGTCTGGGATGCAGGAGTGTGG + Intronic
955057706 3:55471317-55471339 CTGTGTGGGAAACAGGAGTGAGG - Intronic
955596121 3:60592588-60592610 CTGCCTGGGCAGCAGGATGGAGG + Intronic
956829266 3:73029527-73029549 TTGTCTGAGCATCCGAAGTGTGG + Intronic
956864001 3:73351610-73351632 CTCTCTTACCAGCCGGAGTGGGG + Intergenic
959336810 3:105077615-105077637 CTCTCTGAGCTGAAGGGGTGGGG - Intergenic
959531592 3:107439993-107440015 CTGTATGAGGAGCAGGTTTGCGG + Intergenic
959930137 3:111971639-111971661 GTGTATGAGAAGCAGGGGTGGGG - Intronic
962350723 3:134653736-134653758 TTGTGTGAGCAGCTGGAGGGAGG - Intronic
962463983 3:135639745-135639767 CTTTCTGAGCTGCAGTAGTCTGG + Intergenic
962730837 3:138282051-138282073 CTGGCTGAGAAGTAGGAGCGGGG - Intronic
964669850 3:159213056-159213078 GGGTCTGAGGAGCAGCAGTGTGG - Intronic
965722191 3:171674171-171674193 CTGCCTAAGCACCAGGAATGTGG - Intronic
965833814 3:172829017-172829039 CTGTCTGGCCACCTGGAGTGGGG + Intergenic
967266575 3:187697144-187697166 CTGTCTTAGCGGCGGGGGTGGGG - Intergenic
967539167 3:190644923-190644945 CTATCTGAGTACAAGGAGTGTGG - Intronic
968083668 3:195864111-195864133 CTGTCCGTCCACCAGGAGTGGGG - Exonic
968778375 4:2559765-2559787 CTGTCCGTGCAGCCGGAGTCTGG - Intronic
968905040 4:3447081-3447103 CTCTGTGCCCAGCAGGAGTGAGG + Intronic
969443326 4:7229862-7229884 GTGTCTGGGCAGGAGCAGTGTGG + Intronic
969443405 4:7230808-7230830 GTGTCTGGGCAGGAGCAGTGTGG + Intronic
969995978 4:11313687-11313709 CTGTTCTAGGAGCAGGAGTGCGG + Intergenic
970109100 4:12617637-12617659 CTGGCTGACTGGCAGGAGTGTGG + Intergenic
972582603 4:40407806-40407828 CAGTCAGAGAAGCAGGAGGGTGG - Intergenic
974321034 4:60350175-60350197 CAGTCTGAGCAGCAGTTGTTGGG + Intergenic
974562512 4:63540594-63540616 GTGTCTGAGTGGCAGAAGTGAGG + Intergenic
975571041 4:75818109-75818131 CTTTCTGAGCGGCTGGACTGAGG - Intergenic
978361135 4:107931898-107931920 CTGGCTGAGCAGCAGGACCAGGG + Exonic
978838491 4:113182240-113182262 CTGTGTGAGGAGCAGGTTTGAGG + Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982068025 4:151671814-151671836 CTGTGTGGGCAGGGGGAGTGAGG + Intronic
984004052 4:174287025-174287047 CTGGCTAACCAGCAGGAGTTTGG + Intronic
985261323 4:188117788-188117810 GTGGCTGAGCAGTAGGAGTCAGG - Intergenic
985364788 4:189216878-189216900 GTGGGTGAGCAGGAGGAGTGAGG + Intergenic
985491450 5:182066-182088 CTGTCTGAGATGGTGGAGTGTGG - Exonic
985524259 5:394148-394170 CTGTCTGGGTGGCAGGAGGGAGG + Intronic
985716242 5:1463543-1463565 GTGCCTGTACAGCAGGAGTGAGG + Exonic
985812447 5:2099646-2099668 CTTTCTATGCAGGAGGAGTGGGG - Intergenic
986087751 5:4468612-4468634 CTGACTCAGCAGGAGGAGAGAGG - Intergenic
987288762 5:16487987-16488009 CTGTTTAAGCAGCAGCTGTGTGG + Intronic
990823481 5:59870724-59870746 CTGTCTTGGCAGCAGTGGTGAGG - Intronic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
992638365 5:78747203-78747225 ATGGCAGAGCAGCTGGAGTGTGG - Intronic
992664080 5:78988886-78988908 CTGACCGGGCAGCAGGGGTGTGG + Intergenic
992823439 5:80522072-80522094 CTGTCAGAGCAGCATTAGTCAGG + Exonic
992867563 5:80973159-80973181 CTATCAGAGCAGCAGGGGAGAGG - Intronic
997341642 5:133149803-133149825 CTGTCTGGGCAGCAGCCCTGCGG + Intergenic
997916572 5:137932662-137932684 CTTTATCAGCAGCAGCAGTGAGG - Intronic
1001492850 5:172168012-172168034 CTGGCTGAGTGGCAGGTGTGAGG + Intronic
1001562473 5:172678481-172678503 CTGGCTGAGGAGCAGGAGGTGGG - Intronic
1001615806 5:173042661-173042683 CTGTCTAAGCTGCAGGCCTGAGG + Intergenic
1003700837 6:8462894-8462916 CTGCCTGACTAGCAGTAGTGGGG + Intergenic
1004862853 6:19823310-19823332 CTGTGTGAGGAGCAGGTTTGGGG - Intergenic
1005430205 6:25748679-25748701 CTGTCTCAGCAAGAGGAATGTGG + Intergenic
1006338471 6:33432972-33432994 ATCTGTGAGCAGCAGGAGAGGGG + Intronic
1006404876 6:33839083-33839105 CTGTCTGGGGAAGAGGAGTGGGG - Intergenic
1009403690 6:63287434-63287456 CTGTAATACCAGCAGGAGTGAGG + Intronic
1011646370 6:89462456-89462478 ATCTCTGAGCTGCAGGAGAGGGG + Intronic
1011981889 6:93388614-93388636 CTCTCTGACCAGCACGACTGTGG + Intronic
1012557901 6:100538568-100538590 GTATCTGAGCAGCAGGAATTGGG - Intronic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015487923 6:133792479-133792501 CTGGCAAAGCAGCAGAAGTGAGG - Intergenic
1015935560 6:138403936-138403958 CTGGCTGAGCCCCAGGAGTGCGG + Intronic
1017991096 6:159490471-159490493 GTGTCTGAGCAGCAGGAGATGGG - Intergenic
1019716256 7:2540843-2540865 CTCTCTGAGCAGCAGCTCTGTGG + Intronic
1024307944 7:47943887-47943909 GTGAGTGAGCAGCAGGAATGGGG - Intronic
1024582084 7:50808613-50808635 CTGCCCGAGCAGCAGGTCTGCGG + Intergenic
1025708945 7:63890551-63890573 CTGTGGGAGCAGCAGGTGAGTGG + Intergenic
1026844923 7:73693437-73693459 CTGCCTGGGCTGCAGGAGGGAGG + Intronic
1026888980 7:73971175-73971197 CTCACTGAGCAGGGGGAGTGAGG + Intergenic
1028645990 7:93097384-93097406 CTATTGGAGCAGCAGGAGTGGGG + Intergenic
1029128504 7:98312357-98312379 CTGGCTTAGCACCAGGAGTGTGG + Intronic
1029375300 7:100173859-100173881 CTGTCTCAGCAGCAGGGGACTGG - Exonic
1030150249 7:106397366-106397388 CTCTCTGAGTAGGAGGACTGAGG + Intergenic
1030526801 7:110664275-110664297 CTAGATGAGCAGCAGGAGTTAGG + Intronic
1031576096 7:123417564-123417586 CTGTGTAAGCAGCCAGAGTGGGG - Intergenic
1032268232 7:130383118-130383140 CTGTCCGAGCAGCAGAACAGGGG + Intronic
1033235803 7:139637006-139637028 CTGCCTAAGCAGCTGGAGGGTGG - Intronic
1033432672 7:141303462-141303484 CTGTCCGGGCAGCAGGACTCTGG - Intronic
1033651970 7:143350671-143350693 CCATTTGAGCAGCAGGAGGGAGG + Intronic
1034551679 7:151824631-151824653 CTGTGAGAGGAGCAGGAGAGAGG - Intronic
1034567574 7:151927482-151927504 TTGCCTGTGCAGAAGGAGTGAGG + Intergenic
1034593088 7:152160495-152160517 CATTCTGAGAAGCAGGTGTGTGG + Intronic
1034709570 7:153178970-153178992 CTTTTTGAGCAGCAGGAGAATGG - Intergenic
1037902730 8:22697044-22697066 CTGGGTGTGGAGCAGGAGTGGGG + Intergenic
1038441410 8:27573184-27573206 CTGTGAGAACAGCTGGAGTGGGG + Intergenic
1039256901 8:35729036-35729058 ATGTTTGGGCAGGAGGAGTGGGG + Intronic
1039356522 8:36823282-36823304 GTCTCTGAGCAGTAGGACTGGGG - Intronic
1042935706 8:74055867-74055889 CTCTCTGAGCAGCATGATGGTGG + Intergenic
1044372843 8:91433731-91433753 CTCTCTGAGCAGCATCACTGAGG + Intergenic
1045425838 8:102064927-102064949 ATGTCAGAGAAGCAGGACTGGGG - Intronic
1046294566 8:112201215-112201237 TTCTCTGACAAGCAGGAGTGGGG - Intergenic
1047402530 8:124558646-124558668 CTGTCTGAGCAGCAGGCAGGGGG + Intronic
1048245513 8:132793086-132793108 CTGTCAGAGCAGCAGGAGCCGGG + Intronic
1049258050 8:141624374-141624396 CTGTCTGAGCATTAGGGCTGGGG - Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049312468 8:141940483-141940505 CTGTCAGAGCAGCTGGAGAGGGG - Intergenic
1049755747 8:144310656-144310678 CTCCCAGAGCAGCAGGAGCGCGG + Intronic
1050880896 9:10699535-10699557 CTGTCAGATCAGCAGCAGTGGGG + Intergenic
1050881011 9:10700704-10700726 CAGTGTGAGCAGCAGCACTGTGG - Intergenic
1051849748 9:21492611-21492633 CTGTCTGAGCTCCAGCAGTGTGG - Intergenic
1053885925 9:42645209-42645231 TAGTCTGAGCAGTAGGAGGGGGG + Intergenic
1054224943 9:62452658-62452680 TAGTCTGAGCAGTAGGAGGGGGG + Intergenic
1057449084 9:95140577-95140599 CTGTCTGAGCAGTAGAGGGGAGG + Intronic
1057569516 9:96193845-96193867 GTGTCAGAGCAGGTGGAGTGGGG + Intergenic
1057746080 9:97752418-97752440 CTGTTTCAGGAGCAGCAGTGCGG - Intergenic
1057810557 9:98253860-98253882 CTGTCAGAGAACCAGGGGTGGGG + Intronic
1057878925 9:98778532-98778554 CTGTCTGGGCCCCAGGAGAGGGG - Intronic
1061040130 9:128136741-128136763 CTGCCTGGGCAGGATGAGTGAGG - Intergenic
1061589231 9:131588122-131588144 CTCTCTGCCCAGCAGGAGCGTGG + Intronic
1061608215 9:131727668-131727690 CTGCCTGTGCTGCAGGGGTGCGG - Intronic
1061659127 9:132116632-132116654 CTTTCTGAGCAGCATGAGAATGG + Intergenic
1062248272 9:135581222-135581244 CTGAGTGAGGAGTAGGAGTGTGG + Intergenic
1062265914 9:135686404-135686426 CTTTCTGAGGAGCAGGAGCTGGG - Intergenic
1062462426 9:136667492-136667514 CTGGCTGTGCAGCAGGAGCCAGG - Intronic
1187240174 X:17505769-17505791 CTGTCTCTCCAGCAGGGGTGAGG + Intronic
1189128136 X:38469692-38469714 CTGTCTAAAAAGCAGGAGTTTGG - Intronic
1189611982 X:42746738-42746760 CTGTCTCAGCTGCAGAATTGTGG + Intergenic
1190335637 X:49260089-49260111 CTGCGTGAGAAACAGGAGTGTGG + Intronic
1191185127 X:57603304-57603326 CTTTCTCTGCAGCAGGAGAGGGG + Intergenic
1194531587 X:95055710-95055732 CTGGCTGGGCAGCAGGGATGGGG - Intergenic
1194998894 X:100622773-100622795 CTCTCTGGGCAGTGGGAGTGAGG + Intergenic
1195914462 X:109922431-109922453 CTGTCTAAGCAGTAGCACTGGGG - Intergenic
1197708347 X:129649612-129649634 ATGTCTGTGCACCAGGAGGGGGG + Intronic
1198553570 X:137769330-137769352 CTGTCTGACAAGCCGCAGTGAGG + Intergenic
1199505927 X:148561570-148561592 CTGCCTCAGAATCAGGAGTGGGG + Intronic
1200334455 X:155335026-155335048 CTGTGTGAGCAGTAGGATTGGGG - Intergenic