ID: 1141423543

View in Genome Browser
Species Human (GRCh38)
Location 16:83931807-83931829
Sequence TGCCTATCTCAGCCAGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 333}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141423537_1141423543 -3 Left 1141423537 16:83931787-83931809 CCGGAACCGACCGCCACTCATGC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1141423543 16:83931807-83931829 TGCCTATCTCAGCCAGGCTTGGG 0: 1
1: 0
2: 1
3: 22
4: 333
1141423535_1141423543 -1 Left 1141423535 16:83931785-83931807 CCCCGGAACCGACCGCCACTCAT 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1141423543 16:83931807-83931829 TGCCTATCTCAGCCAGGCTTGGG 0: 1
1: 0
2: 1
3: 22
4: 333
1141423536_1141423543 -2 Left 1141423536 16:83931786-83931808 CCCGGAACCGACCGCCACTCATG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 1141423543 16:83931807-83931829 TGCCTATCTCAGCCAGGCTTGGG 0: 1
1: 0
2: 1
3: 22
4: 333
1141423534_1141423543 13 Left 1141423534 16:83931771-83931793 CCATAGTCATCAGGCCCCGGAAC 0: 1
1: 0
2: 0
3: 2
4: 51
Right 1141423543 16:83931807-83931829 TGCCTATCTCAGCCAGGCTTGGG 0: 1
1: 0
2: 1
3: 22
4: 333
1141423538_1141423543 -9 Left 1141423538 16:83931793-83931815 CCGACCGCCACTCATGCCTATCT 0: 1
1: 0
2: 1
3: 9
4: 171
Right 1141423543 16:83931807-83931829 TGCCTATCTCAGCCAGGCTTGGG 0: 1
1: 0
2: 1
3: 22
4: 333
1141423533_1141423543 14 Left 1141423533 16:83931770-83931792 CCCATAGTCATCAGGCCCCGGAA 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1141423543 16:83931807-83931829 TGCCTATCTCAGCCAGGCTTGGG 0: 1
1: 0
2: 1
3: 22
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141423543 Original CRISPR TGCCTATCTCAGCCAGGCTT GGG Intronic
900431647 1:2605669-2605691 AGCCTGCCTCAGCCAGGCTGCGG - Intronic
900466234 1:2826813-2826835 TGCCTACCTGGGCCAGGCTATGG - Intergenic
901905901 1:12410393-12410415 TGCCTAAATCAACCAGGGTTTGG - Intronic
903483423 1:23671163-23671185 TGCCCATCTCAGGCTGGCATGGG + Intergenic
903592276 1:24466161-24466183 TGGCACTCTCAGCCAGGCCTTGG + Intronic
903887183 1:26547299-26547321 TGCCTCCCTCAGCCAAGCCTGGG - Intronic
904120428 1:28194274-28194296 TCCCCATCTCCCCCAGGCTTGGG - Intergenic
904828240 1:33289430-33289452 AGCCTCTCTCCGCCAGGCCTCGG - Intronic
905141006 1:35844387-35844409 AGCAAATCTCAGCCAGGCCTTGG + Intronic
906052761 1:42888307-42888329 CGCGTTTCTCAGCCAGGCTTAGG + Intergenic
906355175 1:45099571-45099593 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
906376251 1:45299166-45299188 TGCCCATCACAGTCAGGCCTTGG + Intronic
906714799 1:47959882-47959904 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
907609754 1:55856603-55856625 TGCCTATTTCAGTCAGACGTTGG + Intergenic
908742368 1:67342034-67342056 TGCCACTCTCAGGCAGGCTTGGG + Intronic
909441499 1:75701179-75701201 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
910803684 1:91170029-91170051 TGCCAATCTTATCCAGGCTGTGG + Intergenic
912429531 1:109621647-109621669 TGCCTTTACCAGGCAGGCTTAGG + Intronic
912432475 1:109636288-109636310 TGCATATCTCCTCCAGGCCTGGG - Intergenic
912742660 1:112215310-112215332 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
915554978 1:156656347-156656369 TGCCTATGTCTGCCTGGCTATGG + Exonic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
915632927 1:157166007-157166029 TGCCCACCTGAGCCAGGCTGAGG - Intergenic
915869386 1:159541767-159541789 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
916456523 1:164976625-164976647 TGCCTATTTCTCCCAGGCCTTGG + Intergenic
916559285 1:165919128-165919150 AGCCTGTGTCAGCCAGGCTTGGG + Intergenic
917981274 1:180271270-180271292 TGCCTACAGCAGGCAGGCTTAGG + Intronic
918118320 1:181515976-181515998 TGCCTGGCTCAGCCAGGCCAAGG - Intronic
919093725 1:193004344-193004366 TTCGTATCTCTGCCAGGTTTTGG - Intergenic
920338445 1:205260171-205260193 AGCCTATCTCAGGCAGGTTGGGG + Intronic
920377284 1:205515988-205516010 AGCCTCTCTCATCCAGGCTGGGG + Intronic
921005045 1:211085032-211085054 TGCATATCTAATCCAGGCTGGGG + Intronic
921250298 1:213291084-213291106 TTGCTATTTAAGCCAGGCTTAGG - Intergenic
923240467 1:232080369-232080391 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
923541934 1:234894497-234894519 TACCTAAATCAGCCAAGCTTTGG + Intergenic
1064540878 10:16403878-16403900 TGACAATCCCAGCCAGGCTGTGG + Intergenic
1065694099 10:28363895-28363917 TCCCTATCACAGCCTGGCTGGGG - Intergenic
1066595651 10:37046997-37047019 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1067282860 10:44886032-44886054 AGCCTGTCCCTGCCAGGCTTGGG - Intergenic
1068477640 10:57548743-57548765 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1069794734 10:71044733-71044755 TGCTCATCTCAGGCAGGCTAGGG - Intergenic
1071210818 10:83339842-83339864 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1071927264 10:90424561-90424583 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1072373523 10:94790837-94790859 TGTGTGTCTCTGCCAGGCTTTGG + Intronic
1075881205 10:125852570-125852592 TGCGTATCTCTGCCTGGCTCTGG + Exonic
1076158869 10:128226038-128226060 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1076408392 10:130229258-130229280 TGGCTATGTCAACCAGGATTAGG + Intergenic
1076757001 10:132577723-132577745 TGCCTGTCTCAGGGAGGCATTGG + Intronic
1077061084 11:618173-618195 TGCCAACCTGTGCCAGGCTTGGG + Intronic
1077636640 11:3846288-3846310 TCCCTCTCTCAGCCAGCCTCAGG + Intergenic
1077808869 11:5617280-5617302 TGCCTATCTCAGCTAAGCATTGG + Intronic
1077946763 11:6908237-6908259 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1078902958 11:15658548-15658570 TCCCTGTCTCAGCCATGCCTCGG - Intergenic
1079426409 11:20346300-20346322 TGTGTATCTCTGCCAGGTTTAGG - Intergenic
1079472729 11:20795014-20795036 TTCCAATCTCTGCTAGGCTTCGG + Intronic
1080175483 11:29357901-29357923 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1080406387 11:31983727-31983749 TGCTTCTCTCAGCAGGGCTTTGG - Intronic
1080982950 11:37430377-37430399 TGTTTTTCTCTGCCAGGCTTTGG + Intergenic
1081132234 11:39394387-39394409 TTTCTGTCTCTGCCAGGCTTTGG + Intergenic
1082887949 11:58108368-58108390 TCCCCAACTCAGCCATGCTTGGG - Intronic
1083532194 11:63433961-63433983 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1084785342 11:71438678-71438700 TGCCTGTCTCTGCCAGCCCTGGG - Intronic
1084916306 11:72431627-72431649 TGGCTGTCTGAGCCATGCTTGGG - Intronic
1085023809 11:73225074-73225096 TGCCTATCTCTGCCAGGAGTTGG - Intronic
1085108827 11:73869453-73869475 TGCCTATCTTGGCTAGGCCTAGG - Intergenic
1085171844 11:74456298-74456320 TCCCTATGTCACCCAGGCTGTGG - Exonic
1086779189 11:90881120-90881142 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1087712818 11:101573362-101573384 TAAGTATCTCAGCCAGGATTTGG - Intronic
1088898134 11:114093252-114093274 GGCCTATCCCAGAGAGGCTTGGG + Intronic
1090071463 11:123548000-123548022 TGCCTACCTCAGGCAGGCTCCGG + Intronic
1090723316 11:129497158-129497180 TGTGTATCTCTGCCAGGCTTTGG - Intergenic
1092327414 12:7547601-7547623 TGTGTATCTCTACCAGGCTTTGG - Intergenic
1093344798 12:18027432-18027454 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1093673283 12:21902962-21902984 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
1094051488 12:26226009-26226031 TGCCAATGTCAGCCAGGTTGAGG + Intronic
1094291700 12:28857934-28857956 TGCCTTTCTAAACCAGGCTTCGG + Intergenic
1096114768 12:49049416-49049438 TGCCCATCTCAACCACTCTTGGG - Intronic
1097183772 12:57185454-57185476 TGCCTTTGTCATCCAGGCTTTGG - Intronic
1097701343 12:62823416-62823438 TGTCTCTCTCTGCCAGGCTTTGG - Intronic
1098116002 12:67177480-67177502 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1099605674 12:84798390-84798412 CACCTTTCTCAGCTAGGCTTAGG - Intergenic
1099740700 12:86630425-86630447 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
1100370509 12:93964944-93964966 AGCCTATCCCTGCCTGGCTTTGG - Intergenic
1100374813 12:94004771-94004793 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1100749023 12:97676607-97676629 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1101020088 12:100545231-100545253 TCCCCACCTCAGCCAGGCTGGGG - Intronic
1101551977 12:105771732-105771754 AGTCTGTGTCAGCCAGGCTTGGG + Intergenic
1101990080 12:109477288-109477310 TGCCTCTCTCAGTCCGGGTTTGG - Exonic
1104000209 12:124855367-124855389 TCCATATCTCACGCAGGCTTTGG + Intronic
1105226829 13:18443210-18443232 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1105411481 13:20174931-20174953 TGCCCATCACAGCCAAGCCTGGG - Intergenic
1106924369 13:34598639-34598661 TGCCTATTACAGACATGCTTGGG - Intergenic
1110606624 13:77440301-77440323 TGCCTGTCTCTGCCAGGCTTTGG + Intergenic
1110699447 13:78529715-78529737 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1111774288 13:92640019-92640041 TGCCAATTTCAGCCAGAATTAGG - Intronic
1112442651 13:99435380-99435402 TGCCCTGCTCTGCCAGGCTTAGG - Intergenic
1112482409 13:99788670-99788692 TGTGTGTCTCTGCCAGGCTTTGG + Intronic
1114789169 14:25636748-25636770 TTCATATCTCAACTAGGCTTAGG - Intergenic
1116634770 14:47380883-47380905 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
1117147601 14:52850773-52850795 TGCTGATCTCATCCAGGCTCAGG + Intergenic
1118066819 14:62201592-62201614 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1119166768 14:72501088-72501110 TGCCAATCTCAGGTGGGCTTTGG + Intronic
1119425185 14:74530459-74530481 TGCCTAGGTCAGCCAGCCTGAGG + Intronic
1120559319 14:85971507-85971529 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1122939867 14:104976452-104976474 TGCCTTTCCCAGCCTGGATTTGG - Intronic
1124668951 15:31620236-31620258 TGTGTGTCTCTGCCAGGCTTTGG + Intronic
1124669916 15:31629562-31629584 TGTGTGTCTCTGCCAGGCTTTGG + Intronic
1125841064 15:42801582-42801604 TGCCAACCGCAGCCAGGCTGAGG - Intronic
1127217756 15:56842865-56842887 TGTCTTTCTCTACCAGGCTTCGG - Intronic
1127294669 15:57598746-57598768 TGCCTGTCCTACCCAGGCTTAGG + Intronic
1128292390 15:66487948-66487970 GGCCTACCTCAGCAATGCTTGGG - Intronic
1129321661 15:74778343-74778365 TTCCCATCTCAGCCAGGCTGAGG - Intergenic
1130275538 15:82474381-82474403 TGCCTATCTCAGTCATGCCCCGG - Intergenic
1130305807 15:82711454-82711476 TGCGGATCAGAGCCAGGCTTAGG + Intergenic
1130485789 15:84397734-84397756 TGCCTATCTCAGTCATGCCCTGG + Intergenic
1130642329 15:85689899-85689921 TCCCTTTCTCAGCCAGTCTCTGG + Intronic
1132191171 15:99862414-99862436 TGCCAATTTCAGCCAGAATTAGG + Intergenic
1132391971 15:101445890-101445912 TGACCAGCTAAGCCAGGCTTGGG + Intronic
1134457036 16:14402315-14402337 TCCCTCTCTCACCCAGGCTGGGG - Intergenic
1135559645 16:23466268-23466290 TAGCCATCTCAGCCAGGCTCAGG + Exonic
1136113615 16:28080550-28080572 TGCTACTATCAGCCAGGCTTGGG - Intergenic
1136778712 16:32884710-32884732 TGGGTACCTGAGCCAGGCTTGGG - Intergenic
1136891906 16:33976804-33976826 TGGGTACCTGAGCCAGGCTTGGG + Intergenic
1137035564 16:35566776-35566798 TGACTGTCCTAGCCAGGCTTCGG - Intergenic
1137444660 16:48524353-48524375 AGTTTATCTCAGCCAGGCCTTGG + Intergenic
1137782030 16:51105602-51105624 TGCCTATCTCAGACTGGCAATGG - Intergenic
1139964059 16:70735795-70735817 TGCCTGAATCAGCCTGGCTTGGG + Intronic
1139994362 16:70966029-70966051 GCCCTGTATCAGCCAGGCTTTGG - Intronic
1140471737 16:75219098-75219120 TCCCCCTCTCAGCCAGGCTCAGG - Intronic
1141423543 16:83931807-83931829 TGCCTATCTCAGCCAGGCTTGGG + Intronic
1203081129 16_KI270728v1_random:1146804-1146826 TGGGTACCTGAGCCAGGCTTGGG - Intergenic
1150975250 17:70078714-70078736 TGCCTTTTTCTGCCAGGCTGGGG - Intronic
1152597602 17:81245624-81245646 TGCCCAGCTCCGCCAGGCTGCGG - Exonic
1153317312 18:3737293-3737315 TGTGTCTCTCTGCCAGGCTTTGG - Intronic
1153961687 18:10145510-10145532 TGACTGTCACAGCCAGGCTTGGG - Intergenic
1156512311 18:37648670-37648692 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1156908032 18:42378254-42378276 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1157063592 18:44321405-44321427 TGCCAACCGCAGCCAGGCTGAGG - Intergenic
1159318959 18:66820595-66820617 TGCAGATGTCAGCCAGGATTTGG - Intergenic
1160340559 18:78085474-78085496 TTCCTCGCCCAGCCAGGCTTGGG + Intergenic
1161269272 19:3380952-3380974 TGCCTATTGCAGCTAGGGTTGGG - Intronic
1163169594 19:15521700-15521722 TCCCTATGTCACCCAGGCTGGGG + Intronic
1163460320 19:17433515-17433537 TTCCTATCTCAGCCAGAATCAGG - Intronic
1163847792 19:19647063-19647085 TGCCTATATCAGCCTGGCCCTGG + Intronic
1164191202 19:22918793-22918815 TGTCTCTCTCAGCGAGGCTTAGG + Intergenic
1164303622 19:23984023-23984045 TGTCTCTCTTAGCTAGGCTTAGG - Intergenic
1164326769 19:24200234-24200256 TGTATGTCTCTGCCAGGCTTTGG + Intergenic
1164495845 19:28760520-28760542 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1164777293 19:30862711-30862733 TGTGTCTCTCAGCCAGGTTTCGG - Intergenic
1165321346 19:35087115-35087137 TGCTTATCTGAGCCATGCCTGGG - Intergenic
1166159265 19:40939557-40939579 TCGCTCTCTCAGCCAGGCTGGGG + Intergenic
1166172289 19:41037760-41037782 TGTGTGTCTCTGCCAGGCTTAGG - Intergenic
1166880381 19:45926051-45926073 TTCCTATCTAAGCCAGGCCCTGG + Intergenic
1166987598 19:46670855-46670877 TGCCTGTCTAAGCCACTCTTGGG - Intergenic
925035267 2:680207-680229 TGCCCATGTCAGCCTGGCTGTGG - Intergenic
925099284 2:1231689-1231711 ACCCTATCTCAGCCACGCTGTGG - Intronic
928463034 2:31493338-31493360 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
930591348 2:53329920-53329942 TTGCTATGTCAGCCAGGCTGGGG - Intergenic
931112379 2:59125315-59125337 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
932001859 2:67892691-67892713 TGCCTTTATCAGCCAGCATTAGG + Intergenic
933296520 2:80497343-80497365 TGCCTTTCTAACCCAGGCATGGG - Intronic
933631634 2:84665772-84665794 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
935472129 2:103473151-103473173 TTTCTGTCTCTGCCAGGCTTTGG + Intergenic
935858005 2:107296294-107296316 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
938217781 2:129535470-129535492 TGTATGTCTCTGCCAGGCTTTGG - Intergenic
939796048 2:146645505-146645527 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
940548818 2:155125361-155125383 TGCCTTTCTCTGCCTGGCCTAGG - Intergenic
940968928 2:159872816-159872838 GGCCTTCCTCAGCCAGGCTGGGG + Intronic
941081865 2:161070993-161071015 TGACTATCTCAGCCAGTGTTTGG + Intergenic
942638527 2:178035548-178035570 TGTCTCTCTCTGCCAGGTTTTGG - Intronic
943979696 2:194532291-194532313 TCCCTATTTCAGCATGGCTTGGG - Intergenic
943998873 2:194806863-194806885 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
944439073 2:199723853-199723875 TGTTTATCTCTGCCAGGTTTTGG + Intergenic
946658585 2:221975720-221975742 TGTCCATCTCAGCCAGCCATGGG + Intergenic
948751831 2:240137569-240137591 TTCCTTGCTCAGCCAGACTTCGG + Intergenic
948888606 2:240896326-240896348 CCCCTGTCCCAGCCAGGCTTGGG + Intronic
949049149 2:241887952-241887974 TGCCTCTCTCCGCCATGCTGGGG + Intergenic
1168790641 20:573606-573628 TTCCTATCACTGCCAGGATTAGG - Intergenic
1168856224 20:1011114-1011136 TGCCCATCTTCCCCAGGCTTTGG + Intergenic
1168896769 20:1329042-1329064 TCCCAATCCCAGCCAGGATTGGG + Intronic
1169730960 20:8785155-8785177 TCCCTTTCTAAGCCAGCCTTAGG - Intronic
1169757844 20:9062617-9062639 TGTATATATCAGCTAGGCTTAGG - Intergenic
1171454931 20:25263953-25263975 TGGTTGTCTCTGCCAGGCTTTGG - Intronic
1173227216 20:41168974-41168996 TGCCTGCCTCACCCTGGCTTAGG + Intronic
1175130920 20:56788966-56788988 TGACTCCCTCAGCCAGGTTTGGG + Intergenic
1175256302 20:57649587-57649609 GGACTGTCTCAGCCTGGCTTTGG + Exonic
1175384731 20:58586995-58587017 TGCCCATCACAGCCATTCTTGGG + Intergenic
1178442681 21:32611864-32611886 TGCCTCTCGGAGCCAGGATTTGG - Intronic
1179630032 21:42671941-42671963 GGCACATCTCAGCCGGGCTTGGG - Intronic
1180836952 22:18934717-18934739 TCCCCATCCCAGCCATGCTTAGG + Intronic
1182373249 22:29827064-29827086 TGGCTCTGTCAGCCAGGCTGGGG - Intronic
1184729422 22:46364674-46364696 TGTCACTCTCAGCCAGGCTCTGG + Exonic
1184788790 22:46686332-46686354 TGCTTAACACAGCCGGGCTTGGG - Exonic
1203287045 22_KI270734v1_random:160016-160038 TCCCCATCCCAGCCATGCTTAGG + Intergenic
949333643 3:2949826-2949848 TGCCTATATCAGTTAGGGTTTGG - Intronic
949576310 3:5342214-5342236 TGCGTATCTGACCCAGGCTCAGG - Intergenic
949628552 3:5895678-5895700 TTTCTGTATCAGCCAGGCTTTGG + Intergenic
949804341 3:7937881-7937903 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
951833467 3:26956103-26956125 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
952642294 3:35612089-35612111 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
954580222 3:51699249-51699271 TGCCTCCCTCAGCAGGGCTTTGG + Intronic
954762858 3:52889625-52889647 TGCCGTGCTCACCCAGGCTTGGG - Intronic
955194743 3:56794887-56794909 TCCCTATTTCACCCAGGCTAGGG + Intronic
958578792 3:95989347-95989369 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
960521451 3:118660019-118660041 TGCAAATCTCAGCCTGGCTATGG - Intergenic
960793211 3:121455906-121455928 TGGTTGTCTCTGCCAGGCTTTGG - Intronic
961151231 3:124639990-124640012 AGAATATCTCAGCCATGCTTGGG + Intronic
961363416 3:126382572-126382594 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
961527490 3:127515224-127515246 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
962460491 3:135607665-135607687 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
963082827 3:141410203-141410225 TGCCGATATTAGCCAGACTTTGG + Intronic
963159641 3:142137843-142137865 TTTCTGTCTCTGCCAGGCTTTGG + Intronic
964161891 3:153655536-153655558 TGTGTGTCTCCGCCAGGCTTTGG - Intergenic
965311411 3:167133002-167133024 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
966477885 3:180371034-180371056 TGTGTATCTCTGCCAGGCTTTGG - Intergenic
966512395 3:180778558-180778580 TGCATGTCTCTACCAGGCTTTGG + Intronic
968567759 4:1323428-1323450 TGCCAAACTCAGCCAGGGTGAGG - Intronic
968808383 4:2789050-2789072 TGCCCATCCTAGCCAGGTTTTGG - Intergenic
970183161 4:13420429-13420451 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
971492758 4:27231348-27231370 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
972631370 4:40844636-40844658 CACCTATCAAAGCCAGGCTTGGG + Intronic
973625746 4:52770624-52770646 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
974823441 4:67097209-67097231 TGGTTGTCTCTGCCAGGCTTTGG + Intergenic
975232485 4:71951230-71951252 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
977192288 4:94015944-94015966 TGCCTATCTCAGCTTTTCTTTGG - Intergenic
978006969 4:103628820-103628842 TTTTTATCTCTGCCAGGCTTTGG - Intronic
978204985 4:106070612-106070634 TGTGTGTCTCTGCCAGGCTTTGG + Intronic
979777933 4:124614408-124614430 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
981795929 4:148595435-148595457 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
982653629 4:158118936-158118958 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
982785360 4:159530494-159530516 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
982792725 4:159611890-159611912 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
983666556 4:170190441-170190463 CACCTTTCTCAGCTAGGCTTAGG + Intergenic
984457282 4:179986326-179986348 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
985119917 4:186630227-186630249 TGAATATCTCAGCCAGTCTCTGG - Intronic
985233220 4:187844515-187844537 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
986687709 5:10288873-10288895 TGCCCCTCTCAGCCAGCCTGGGG + Intronic
987444875 5:18005241-18005263 TCCATGTCTCTGCCAGGCTTTGG + Intergenic
987456273 5:18150986-18151008 TCCCCATATCAGCCAGGCCTGGG - Intergenic
987973442 5:24980314-24980336 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
988523061 5:31963567-31963589 TGCCCATCCCAGCGAGGCTGCGG - Intronic
988672055 5:33392356-33392378 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
989237176 5:39161856-39161878 TGCCTATGGCAGCAAGGTTTGGG - Intronic
990891765 5:60658538-60658560 CACCTTTCTCAGCTAGGCTTAGG - Intronic
991224799 5:64257674-64257696 TGTGTGTCTCTGCCAGGCTTTGG + Intronic
991575653 5:68100793-68100815 GGCTTATCTCAGCCATGCTAAGG + Intergenic
992380227 5:76229184-76229206 TGCCTATGTCTGCCAGGCTGAGG + Intronic
992604103 5:78437683-78437705 TGTGTATCTCTGCCAGGCTTTGG + Intronic
992875949 5:81055599-81055621 TGTGTGTCTCTGCCAGGCTTTGG + Intronic
993914126 5:93720996-93721018 TGCCTTTCACAACAAGGCTTTGG - Intronic
994646025 5:102470128-102470150 TGTGTGTCTCTGCCAGGCTTTGG + Intronic
994888725 5:105601267-105601289 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
995538390 5:113160118-113160140 TCCCTATATCAGCCATCCTTGGG - Intronic
995870594 5:116739852-116739874 TGTCTATCTCCGCCCAGCTTAGG + Intergenic
996759439 5:126972525-126972547 TGCTTGTCTCACCCAGGCCTCGG + Intronic
996989740 5:129614208-129614230 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
997384631 5:133463000-133463022 GGCATTCCTCAGCCAGGCTTTGG - Intronic
999589454 5:153128900-153128922 TGCCTATCAAAGTCAGTCTTTGG - Intergenic
1001841214 5:174878295-174878317 TGCCTATCTGACCAAGGCTTTGG + Intergenic
1002183189 5:177441942-177441964 TGCCAAACTCAGCCAGGCCAGGG - Exonic
1002338174 5:178494814-178494836 TGCCCTCCTGAGCCAGGCTTTGG + Intronic
1002379063 5:178812088-178812110 TGGATTTCTCAGCCTGGCTTTGG - Intergenic
1002421454 5:179151429-179151451 TGCACATCCCAGCCAGGCCTAGG - Intronic
1002797099 6:481976-481998 TGGTTGTCTCTGCCAGGCTTTGG + Intergenic
1002831552 6:826433-826455 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1003871546 6:10407381-10407403 TTCCTATCATACCCAGGCTTAGG - Intronic
1004871959 6:19914035-19914057 TGCCTTTCTCTGCCATGATTTGG - Intergenic
1005511267 6:26513511-26513533 TGGGTAACTCAGACAGGCTTTGG - Intergenic
1005809562 6:29505725-29505747 TGCTTTTCTCACCCAGGCTGTGG - Intergenic
1006780313 6:36627952-36627974 GGCCTATGTCAGCCAGGCTGAGG - Intergenic
1007199344 6:40092819-40092841 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1007250296 6:40490666-40490688 TGCCCCTCACAGCCAGGCCTGGG + Intronic
1008339505 6:50347387-50347409 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1010491934 6:76487237-76487259 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1011190371 6:84721085-84721107 TGCCTTCCCCAGCTAGGCTTAGG + Intronic
1011244191 6:85304686-85304708 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1011525245 6:88257273-88257295 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1012725535 6:102805877-102805899 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1014184984 6:118424702-118424724 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1014954309 6:127596811-127596833 TGGTTGTCTCTGCCAGGCTTTGG - Intergenic
1015045964 6:128776684-128776706 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1016485976 6:144540009-144540031 TCCCTGTCTCACCCAGGCTGGGG - Intronic
1016585233 6:145676951-145676973 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
1017279960 6:152612671-152612693 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
1017709168 6:157150746-157150768 TGCTTATCCCAGCCAGTCTGGGG + Intronic
1020132808 7:5569149-5569171 TTCCTCTCTCACCCAGGCTAGGG - Intergenic
1020145694 7:5640811-5640833 GGGCTATCTCCGTCAGGCTTTGG + Intronic
1020735685 7:11946489-11946511 TTCGTGTCTCCGCCAGGCTTGGG + Intergenic
1022521931 7:31014022-31014044 TGTCTCTCTGAGCCAGACTTGGG - Intergenic
1025156447 7:56611551-56611573 TGCCTCTCATAGCTAGGCTTAGG - Intergenic
1025760430 7:64384197-64384219 TGCCTCTCATAGCTAGGCTTAGG + Intergenic
1026044642 7:66898568-66898590 TGGCTCTGTCAGCCAGGCTGGGG + Intergenic
1026539395 7:71267185-71267207 TGCCTGTCCAAGCCAGGCTCTGG + Intronic
1027242783 7:76343721-76343743 TGCCTATCTCATACTTGCTTAGG - Intronic
1027330425 7:77086978-77087000 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1027574818 7:79918728-79918750 TGTGTCTCTCTGCCAGGCTTTGG - Intergenic
1027952773 7:84839046-84839068 TGACCTTCTCAGTCAGGCTTAGG - Intergenic
1028056699 7:86254297-86254319 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1028211614 7:88081013-88081035 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
1028428166 7:90714396-90714418 TGCATCTCTCAGGCAGGATTTGG + Intronic
1029785336 7:102784356-102784378 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
1030746374 7:113171580-113171602 TAGCTGTCTCAGCCAAGCTTTGG + Intergenic
1031216024 7:118892430-118892452 TACCTCTCTGAGCCAGGCTGGGG - Intergenic
1031612228 7:123841461-123841483 TGTGTATCTCTGCCAGTCTTTGG + Intronic
1031664243 7:124465194-124465216 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1032487645 7:132300037-132300059 TCCCAATGTCAGGCAGGCTTTGG - Intronic
1033631494 7:143162683-143162705 TGTTTGTCTCTGCCAGGCTTTGG + Intergenic
1034116128 7:148585569-148585591 GGCCAATCAGAGCCAGGCTTGGG - Intergenic
1037023377 8:14001816-14001838 GTTCTATCTCTGCCAGGCTTTGG - Intergenic
1037465433 8:19155242-19155264 TCCCCATCTGACCCAGGCTTAGG - Intergenic
1037917271 8:22780303-22780325 TTCCTTTCTCACCCAGGCCTGGG + Intronic
1039158474 8:34589959-34589981 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1040326926 8:46351067-46351089 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1040445432 8:47488524-47488546 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
1042794451 8:72645442-72645464 TGCCTAGCTAAGGCAGGATTGGG - Intronic
1043204539 8:77420529-77420551 TCTCCATGTCAGCCAGGCTTTGG + Intergenic
1043278566 8:78433728-78433750 TGCTAATCTCAGCTTGGCTTTGG + Intergenic
1043725461 8:83605096-83605118 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1043929833 8:86077985-86078007 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
1044665315 8:94628702-94628724 TTGCTCTCTCAGCCAGGCTAGGG + Intergenic
1044729427 8:95218305-95218327 TGCCCAGCTCCTCCAGGCTTAGG + Intergenic
1045070831 8:98502872-98502894 TGTGTGTCTCTGCCAGGCTTTGG + Intronic
1045732650 8:105260292-105260314 TGTTTATCTCTGCCAGGTTTTGG + Intronic
1049420450 8:142514090-142514112 TGCCTAGCTTAGCCTGGCTGGGG + Intronic
1049875487 8:145016302-145016324 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1050049629 9:1585888-1585910 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1051573415 9:18585622-18585644 TGTCTCTCTCTGCCAGGTTTTGG - Intronic
1052018680 9:23499627-23499649 TGCCTACCACAGCTAGCCTTTGG - Intergenic
1052484603 9:29081098-29081120 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1052645307 9:31226981-31227003 TGTCTCTCTCTGCCAGGCTTTGG + Intergenic
1053398768 9:37799993-37800015 TGGCTATCTCAGCCATTCCTTGG + Intronic
1056332991 9:85537172-85537194 TGCCTCTGTCACCCAGGCTGGGG + Intergenic
1057573763 9:96223151-96223173 TGACTGTCTCACACAGGCTTTGG - Intergenic
1058650830 9:107174555-107174577 TGTCTTCCTCAGCCAGGCTGTGG - Intergenic
1058682432 9:107451890-107451912 TGCCTTTCAGAGCCACGCTTTGG + Intergenic
1060335009 9:122713471-122713493 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1060506927 9:124204776-124204798 TTACTATCTTAGCCAGGCTGGGG + Intergenic
1060748860 9:126155744-126155766 CGCCTCACTCAGCCAGGCCTCGG + Intergenic
1191804795 X:65123398-65123420 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1191886166 X:65890478-65890500 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1192021574 X:67397999-67398021 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1192936093 X:75859656-75859678 TGTGTGTCTCAGCCAGGCTTTGG + Intergenic
1193036176 X:76953826-76953848 TGTATGTCTCCGCCAGGCTTTGG - Intergenic
1193259615 X:79390193-79390215 TGTTTGTCTCTGCCAGGCTTTGG - Intergenic
1193685786 X:84575210-84575232 TTCCTGTCTCTGCCAGGTTTTGG - Intergenic
1195332463 X:103815109-103815131 TGTCTGTCTCTGCCAGGCTTTGG - Intergenic
1195827098 X:109014037-109014059 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1195846282 X:109232459-109232481 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1196042118 X:111215876-111215898 TGCCTCTCTCATCCAGGCACTGG + Intronic
1196115544 X:111995433-111995455 TGTGTGTCTCTGCCAGGCTTTGG + Intronic
1198050095 X:132943531-132943553 TGTGTGTCTCTGCCAGGCTTTGG - Intronic
1199563940 X:149194571-149194593 TGTGTGTCTCTGCCAGGCTTTGG - Intergenic
1201302434 Y:12520870-12520892 TGTGTGTCTCTGCCAGGCTTTGG + Intergenic
1202368287 Y:24181354-24181376 TGCCTATCTCAGTCATGCCCCGG + Intergenic
1202372410 Y:24207828-24207850 TGCCTATCTCAGTCATGCCCCGG - Intergenic
1202498375 Y:25462292-25462314 TGCCTATCTCAGTCATGCCCCGG + Intergenic
1202502498 Y:25488763-25488785 TGCCTATCTCAGTCATGCCCCGG - Intergenic