ID: 1141424691

View in Genome Browser
Species Human (GRCh38)
Location 16:83937140-83937162
Sequence CTGTCTTCCCACTGAGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 288}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141424691_1141424693 -9 Left 1141424691 16:83937140-83937162 CCTGCTCCTCAGTGGGAAGACAG 0: 1
1: 0
2: 3
3: 36
4: 288
Right 1141424693 16:83937154-83937176 GGAAGACAGAAGCACCAGAGTGG 0: 1
1: 0
2: 1
3: 47
4: 468
1141424691_1141424697 27 Left 1141424691 16:83937140-83937162 CCTGCTCCTCAGTGGGAAGACAG 0: 1
1: 0
2: 3
3: 36
4: 288
Right 1141424697 16:83937190-83937212 TCCTCAACTGACAGAGCTTAGGG 0: 1
1: 0
2: 0
3: 18
4: 158
1141424691_1141424694 0 Left 1141424691 16:83937140-83937162 CCTGCTCCTCAGTGGGAAGACAG 0: 1
1: 0
2: 3
3: 36
4: 288
Right 1141424694 16:83937163-83937185 AAGCACCAGAGTGGCTTCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 147
1141424691_1141424696 26 Left 1141424691 16:83937140-83937162 CCTGCTCCTCAGTGGGAAGACAG 0: 1
1: 0
2: 3
3: 36
4: 288
Right 1141424696 16:83937189-83937211 GTCCTCAACTGACAGAGCTTAGG 0: 1
1: 0
2: 0
3: 17
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141424691 Original CRISPR CTGTCTTCCCACTGAGGAGC AGG (reversed) Intronic
900344336 1:2203955-2203977 CTGACCTCCCACTGGGGATCGGG + Intronic
900953366 1:5872186-5872208 CCGTCTTCCCACGGAGGCCCTGG + Intronic
901052513 1:6432397-6432419 CTGTGTCCGCACTGAGGAGGTGG + Intronic
901932071 1:12602293-12602315 CTGTCTTCCCAGGCAGGGGCTGG - Intronic
902481730 1:16715639-16715661 CTGTGTCCACACTGAGGAGGTGG - Intergenic
902927730 1:19707865-19707887 TTGTCTTCCCATGGTGGAGCAGG + Intronic
903175109 1:21575965-21575987 CTGTCTACCCACCTGGGAGCAGG + Intronic
903704277 1:25273525-25273547 CTTTCTTCTCACTTAGGGGCTGG + Intronic
903722962 1:25419792-25419814 CTTTCTTCTCACTTAGGGGCTGG - Intronic
904607426 1:31705372-31705394 CTGTGGTCCCAGTGAGGAGCTGG + Intergenic
904876205 1:33656458-33656480 CCTAATTCCCACTGAGGAGCAGG + Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
905447912 1:38039248-38039270 CTGTCTTCCCACTTGGAAGGAGG - Intergenic
906708593 1:47912874-47912896 CTTTCTTCCCACTGAGCCTCAGG - Intronic
907111862 1:51934028-51934050 CTCTCTGCCCAGTGAGGAGAGGG - Intronic
907354141 1:53858262-53858284 CTGTCTTACCATTAAGGAACTGG + Intronic
910968859 1:92833991-92834013 CAATCCTCCCACTGAGTAGCTGG - Intronic
911536623 1:99107637-99107659 ATGTCTTCCCCCTGTGGAGCAGG - Intergenic
914923636 1:151864900-151864922 CTGTTTTCCATGTGAGGAGCTGG - Intergenic
916472279 1:165136134-165136156 CTGTCTTCCCTCTGAGGCTAAGG - Intergenic
916498289 1:165364947-165364969 CTTTCTTCCCGCTGGGTAGCAGG + Intergenic
916965002 1:169929109-169929131 TTGTCTTACCACTGAGTATCAGG + Intronic
917643466 1:177006784-177006806 CTGTCTACCCCCAGAGGAGGGGG - Intronic
918293590 1:183133632-183133654 CTGTCCTCCCACTGACTCGCTGG + Intronic
918957853 1:191234451-191234473 CTGTCTGCAAGCTGAGGAGCAGG - Intergenic
920493762 1:206439475-206439497 CTCTCTTCCCACCGAGAAGTAGG + Intronic
920507919 1:206529808-206529830 CAATCCTCCCACTGAGTAGCTGG - Intronic
920849095 1:209616522-209616544 CTGTCTTCACACTCTGGATCCGG + Exonic
922324192 1:224513261-224513283 CAATCATCCCACTGAGTAGCTGG + Intronic
922643862 1:227265016-227265038 CTGTCATCACACTGAGGATTTGG + Intronic
922712772 1:227845684-227845706 CTGGCCTCCCACTGACTAGCAGG + Intronic
922912098 1:229226520-229226542 CTGTCTTCCAACTGGGGGGCTGG - Intergenic
923524320 1:234760444-234760466 CTTCCTTCCCAATGAGAAGCAGG + Intergenic
1062824660 10:558837-558859 CTGCTCTCCCACTGAAGAGCTGG + Intronic
1063467396 10:6256026-6256048 CTGACTTGCCACTAATGAGCTGG + Intergenic
1064588831 10:16867232-16867254 CTGTCTTTCCCCTGAAGAGAGGG - Intronic
1065973318 10:30822189-30822211 CTGTCTCCCTCCAGAGGAGCAGG + Intronic
1066302002 10:34105506-34105528 GAGTCTTCCCACTGTGAAGCTGG - Intergenic
1067791132 10:49288600-49288622 CTGTGTGCCCTCTGATGAGCAGG - Intergenic
1069201341 10:65620715-65620737 CTGTCAGCCCCCTGAGTAGCTGG + Intergenic
1069989875 10:72308648-72308670 CTCCCTTCCCTCTGTGGAGCTGG - Intergenic
1070776069 10:79110628-79110650 CTGGCTTCCCATTGTGGGGCTGG - Intronic
1073350061 10:102813199-102813221 CTGTCAGTCCTCTGAGGAGCAGG + Exonic
1074311607 10:112327573-112327595 TTGGCTTCACACTAAGGAGCTGG - Intergenic
1074396883 10:113105346-113105368 ATTTCTTCCCAGAGAGGAGCAGG - Intronic
1075223502 10:120604269-120604291 CTGTCTTGCCATTCTGGAGCTGG - Intergenic
1075399316 10:122150023-122150045 CTGGCTTCAGCCTGAGGAGCAGG + Intronic
1076104653 10:127811735-127811757 GTTTCTTCTCACTGAGGAGCTGG + Intergenic
1076272693 10:129168570-129168592 CTGCTTTCCTACTGGGGAGCCGG + Intergenic
1076469208 10:130706964-130706986 CTCTCTGCCCACAGAGGGGCTGG + Intergenic
1076561194 10:131365714-131365736 CTGGCTTCCCTCAGAGGAGGTGG - Intergenic
1076576766 10:131474657-131474679 CTGTCTGCAAGCTGAGGAGCGGG + Intergenic
1076761136 10:132606276-132606298 CTGTCCCGCCACTGAGGACCCGG - Intronic
1076761151 10:132606327-132606349 CTGTCCCGCCACTGAGGACCCGG - Intronic
1077169576 11:1160234-1160256 CAGTGATCCCACTGAGGGGCTGG - Intronic
1077376555 11:2207936-2207958 GTTTGTTCCCTCTGAGGAGCAGG + Intergenic
1077445551 11:2589033-2589055 GAGTCTTCCCAAGGAGGAGCTGG + Intronic
1077509771 11:2952100-2952122 CTGTTCTCACACCGAGGAGCAGG + Intronic
1077734655 11:4776742-4776764 ATGTCTTACCACGGTGGAGCAGG - Intronic
1078008511 11:7550950-7550972 CCGTCTGCAAACTGAGGAGCAGG - Intronic
1078177845 11:8983924-8983946 CTGTCTTCCCCATGATCAGCCGG + Exonic
1081307214 11:41527601-41527623 CTGTCTTACCACAGAAGAGATGG - Intergenic
1081390583 11:42524423-42524445 CTGTCTCCACACTAAGGAGGGGG + Intergenic
1082621116 11:55423556-55423578 CTGTGTTTCTACTGAGGAGTAGG + Intergenic
1084231466 11:67756796-67756818 CTGTCTTCCCTCTGGGAGGCAGG + Intergenic
1084968313 11:72755851-72755873 CTGTCTTCCCCATGAGGAGGAGG + Intronic
1085395415 11:76204795-76204817 CGGTGTTCCCACTGTGGAGCAGG + Intronic
1086987029 11:93261744-93261766 CTTTCTTCCCCCTGAGAAGAGGG - Intergenic
1088264713 11:107978146-107978168 CTGTCTGCAAGCTGAGGAGCAGG - Intergenic
1089203415 11:116739370-116739392 CTTCCCTCCCACTGAGGAACTGG + Intergenic
1090068474 11:123524171-123524193 CTATATCCCCACTGAGGAGGAGG - Intergenic
1090985110 11:131759627-131759649 CTAGCTTCCCACGGAAGAGCTGG - Intronic
1091783707 12:3229887-3229909 CTGGCTTCCCACACAGCAGCAGG - Intronic
1092125813 12:6074298-6074320 CTGTCCTTGCAGTGAGGAGCTGG - Intronic
1095523860 12:43101514-43101536 CTGTCCTCTCACTGTGGACCAGG + Intergenic
1097311333 12:58122518-58122540 CTGTCTCCTCCCTGAGGGGCTGG - Intergenic
1100021041 12:90069961-90069983 CTCTCTGCTCACTCAGGAGCTGG + Intergenic
1100335191 12:93622687-93622709 CTGCCTTCCCACTTAAGGGCAGG - Intergenic
1102436801 12:112930469-112930491 CTCACTGCCCACTGCGGAGCTGG + Intronic
1102449191 12:113027929-113027951 ATGTCTTTCCACGGTGGAGCAGG - Intergenic
1102537005 12:113589188-113589210 CTTTCTTCTCACAGAGGGGCAGG - Intergenic
1102846755 12:116193011-116193033 CTGTCAGCCCCCTGAGTAGCTGG - Intronic
1102923635 12:116810761-116810783 CTGTCTTCCCCCTCAGGAGCAGG - Intronic
1104645856 12:130496800-130496822 CTGTCCTCTCCCTGAGGAGTGGG + Intronic
1106451737 13:29888541-29888563 CTGTCTTCCCAGAGAGCATCAGG - Intergenic
1108275880 13:48809238-48809260 ATGTCTTCCCGGTGAGGAGTAGG - Intergenic
1108385019 13:49891850-49891872 CAGCCATGCCACTGAGGAGCTGG + Intergenic
1111510443 13:89255078-89255100 CTGTCTCACTACTGAGTAGCTGG - Intergenic
1111595711 13:90407370-90407392 ATGTCTTACCATGGAGGAGCAGG + Intergenic
1115681412 14:35742935-35742957 CTGTCTTGCCCCTGAGCTGCTGG - Intronic
1119017832 14:71077938-71077960 CAGTCTACCCACTCAGGAACAGG + Intronic
1119176086 14:72568538-72568560 CCTTCTTCCCAGTGAGGACCTGG + Intergenic
1119396616 14:74330871-74330893 CTGTTTTGCCAATGAGGAGGTGG - Intronic
1119712307 14:76831045-76831067 CTGACTTCCCAGACAGGAGCAGG + Intronic
1120740962 14:88108385-88108407 CTGCCTTCCAACTGACGAGAAGG + Intergenic
1121489876 14:94350116-94350138 CTGTCTGCAAGCTGAGGAGCAGG + Intergenic
1121963277 14:98280992-98281014 ACCTCTGCCCACTGAGGAGCTGG - Intergenic
1122096771 14:99378146-99378168 CTGTCTCCCCATCGAGGTGCTGG + Intergenic
1124962696 15:34410267-34410289 CTGCCTACCCCCTGAGGTGCGGG + Intronic
1124979321 15:34556489-34556511 CTGCCTACCCCCTGAGGTGCGGG + Intronic
1125472988 15:40022662-40022684 CTGCCTTCACACTGAGGCCCGGG + Intronic
1126063061 15:44802574-44802596 CTGGCTTTCCACTGAGATGCAGG + Intergenic
1126671585 15:51120280-51120302 CTGTCTTACCAATGAGGAGAGGG - Intergenic
1127111899 15:55683254-55683276 ATGTCTGCCAACTCAGGAGCAGG + Intronic
1128601516 15:68999048-68999070 CTGTTTTCCCACTTAGCAGCTGG - Intronic
1129209327 15:74058094-74058116 CTGTCTGCCTCCTGAGTAGCTGG + Intergenic
1129705993 15:77794933-77794955 CTGTCCTCACACTGGGAAGCTGG - Intronic
1132040342 15:98520255-98520277 CTGTCTTCCCACTGGGGAGAAGG - Intergenic
1132622222 16:873258-873280 CTGATTTCCCTCTGAGGAGATGG - Intronic
1132761051 16:1508862-1508884 ATGTCTTCCCACGGAGCAGCTGG + Intronic
1133406352 16:5527626-5527648 CTGTCTTCCCATTGGAGGGCAGG + Intergenic
1133763782 16:8821284-8821306 CTGGCCTCCCACACAGGAGCGGG - Intronic
1141424691 16:83937140-83937162 CTGTCTTCCCACTGAGGAGCAGG - Intronic
1142479900 17:212899-212921 CTGTCTTCAGCTTGAGGAGCTGG - Exonic
1143048886 17:4105913-4105935 CAGTGTTCCCACAGAGAAGCTGG + Intronic
1143334780 17:6164082-6164104 CTGTCTGCAGACTGAGGAGATGG + Intergenic
1143395556 17:6592733-6592755 ATCTCTTCCCACTTAGGAGTAGG + Intronic
1144202897 17:12957071-12957093 CCCTCTACCCACTGAGTAGCTGG + Intronic
1144793668 17:17876722-17876744 TTGCCCTCCCACTGATGAGCTGG - Intronic
1145763648 17:27443159-27443181 TAGTCTTCCCCCTGAGCAGCTGG - Intergenic
1146183856 17:30712488-30712510 CTGCCTCCCCACGGAGGGGCTGG - Intergenic
1146184532 17:30716473-30716495 CTGTCTCTCCACGGGGGAGCTGG - Intergenic
1146525409 17:33563178-33563200 CTGTCTTCCCACTTATCAGAAGG - Intronic
1146808823 17:35887430-35887452 CTGCCTCCCCACTGAGTAGCTGG - Intergenic
1147938129 17:44025362-44025384 CTGTCTGGCCACTGAGGATAGGG + Intergenic
1148583022 17:48756631-48756653 AACTCTCCCCACTGAGGAGCTGG - Intergenic
1148587119 17:48788793-48788815 CTGTCTTCCCTGTAAGGAGCGGG - Intronic
1148611867 17:48970006-48970028 CTGTCTTCCTGCTCAGGGGCAGG + Intergenic
1148861969 17:50609251-50609273 CTGTGTTCCCTGTGAAGAGCGGG + Intronic
1149095733 17:52838260-52838282 CTGTCTGTCAACTGAGGAGCAGG + Intergenic
1149591180 17:57831005-57831027 CTGGCTTCCCGCTGAGAACCAGG - Intergenic
1149686908 17:58541080-58541102 CTTTGCTCCCTCTGAGGAGCAGG + Intergenic
1149937399 17:60821788-60821810 CGATCCTCCCACTGGGGAGCTGG + Intronic
1152207911 17:78985099-78985121 CTGTCTTCCCACCATGGTGCTGG - Intergenic
1152370167 17:79882687-79882709 TGGTCTTCCCATTGAGGAGGAGG - Intergenic
1152875202 17:82782469-82782491 CTGTGGTCCCTCTGAGGAGCGGG + Intronic
1153972032 18:10235742-10235764 CTGGGTTCCCAGTGAGGGGCTGG - Intergenic
1155501667 18:26492516-26492538 CCATCCTCCCACTGAGTAGCTGG - Intronic
1155596047 18:27488781-27488803 CTGTCTTACCATGGCGGAGCAGG + Intergenic
1156281757 18:35646143-35646165 ATGTCTTACCATGGAGGAGCAGG + Intronic
1157876513 18:51278975-51278997 CTCTTTTCCCACTGAGGATGTGG + Intergenic
1159955556 18:74516155-74516177 CTGTCTGCTCACCGAGGAGCTGG - Intronic
1160328148 18:77969078-77969100 CTGTCTTCCCTCCCAGGAGCAGG + Intergenic
1160328172 18:77969174-77969196 CTGTCTTCCCTCCCAGGAGCAGG + Intergenic
1160328190 18:77969238-77969260 CTGTCTTCCCTCCCAGGAGCAGG + Intergenic
1160328207 18:77969302-77969324 CTGTCTTCCCTCCCAGGAGCAGG + Intergenic
1160328225 18:77969366-77969388 CTGTCTTCCCTCCCAGGAGCAGG + Intergenic
1160328269 18:77969526-77969548 CTGTCTTCCCTCCCAGGGGCAGG + Intergenic
1160328303 18:77969660-77969682 CTGTCTTCCCTCCCAGGGGCAGG + Intergenic
1160328322 18:77969724-77969746 CTGTCTTCCCTCCCAGGGGCAGG + Intergenic
1160328354 18:77969864-77969886 CTGTCTTCCCTCCCAGGAGCAGG + Intergenic
1160518234 18:79490099-79490121 CTGTCTGCCCACGGGGGGGCGGG - Intronic
1161323390 19:3651659-3651681 CTGGCTTCGCTCTGAGGCGCTGG + Intronic
1162460669 19:10812169-10812191 CTGGCTTCCCACTGAGCTGTGGG + Intronic
1162974245 19:14199201-14199223 CTGTCTCTCCACGGGGGAGCTGG + Intronic
1162974928 19:14203194-14203216 CTGCCTCCCCACAGAGGGGCTGG + Intronic
1163035727 19:14567822-14567844 CTCTCATCCCACTGAGGCCCAGG + Intronic
1163625692 19:18388272-18388294 CTGTCTTCCCACAGTGCGGCTGG + Exonic
1165712257 19:38020393-38020415 CTGTCTTCCATCTGATTAGCTGG + Intronic
1167510383 19:49892705-49892727 CTGCCTTCCCTCTGAGGTCCTGG - Intronic
1202715769 1_KI270714v1_random:41551-41573 CTGTGTCCACACTGAGGAGGTGG - Intergenic
925123040 2:1434002-1434024 CCATCTTCCCACTGAGTTGCTGG + Intronic
926087413 2:10028966-10028988 CTGTCCTCTGAATGAGGAGCGGG + Intergenic
926107594 2:10162136-10162158 CTCTCTTCCCACTAAACAGCAGG - Intronic
926113463 2:10196818-10196840 CTGTCTTCACTCTGAGGCCCTGG - Intronic
926151548 2:10428376-10428398 CTGTCCTCCCACTGAGGGACAGG + Intergenic
926435730 2:12835754-12835776 CTCTTTTCCCACTGAGGAGGTGG + Intergenic
926616265 2:14999571-14999593 ATGTCTTCCCATGGTGGAGCAGG - Intergenic
927489880 2:23514235-23514257 CTGTTTTTCATCTGAGGAGCTGG + Intronic
928006398 2:27566040-27566062 TTTTCTTCCCACTGTGGATCTGG - Exonic
930299068 2:49592984-49593006 ACATCTTCCCATTGAGGAGCTGG - Intergenic
930945706 2:57072332-57072354 CTGTCTTAACATTGAGGAGAAGG - Intergenic
930946224 2:57079255-57079277 ATGTCTTACCACAGTGGAGCAGG - Intergenic
931561610 2:63567529-63567551 CTCTCTCCCACCTGAGGAGCTGG + Intronic
932557401 2:72836958-72836980 CTGCCTTCCTCCTGAAGAGCTGG + Intergenic
933227179 2:79764126-79764148 CTCTTTCCCCACTGAGGAGTAGG - Intronic
934912945 2:98275902-98275924 CTGCCTTCCCAGTGAAGATCTGG - Intronic
939740329 2:145898562-145898584 CTGTCTTCTCACTAAAGAGGGGG + Intergenic
940564172 2:155339479-155339501 ATGTCCTCCCTCTGAGAAGCAGG - Intergenic
940981841 2:160012283-160012305 CTGTCTTCCCCAGGAGGAGTGGG + Intronic
941569228 2:167148623-167148645 TTGTCTTTCCACTGAAGAGTTGG - Intronic
941745263 2:169080360-169080382 CTCCCTCCCCACAGAGGAGCAGG - Intronic
942942316 2:181632824-181632846 CTTTCTGCCTCCTGAGGAGCAGG - Intronic
944406888 2:199394684-199394706 CTGTCAGCCCCCTGAGTAGCTGG - Intronic
945775713 2:214103899-214103921 CTTTCTTCCCTCTGGGGAGTGGG + Intronic
946174033 2:217911876-217911898 GTGTCTTCCTACTGAGGACCTGG - Intronic
946230209 2:218286660-218286682 CTGTCTGCCTACTGAGGCCCCGG + Exonic
947538896 2:230960945-230960967 CTGTCTTCACAGTGAGAAACTGG - Intronic
948232047 2:236355972-236355994 CTGTGAGCCCACAGAGGAGCCGG + Intronic
948376476 2:237524373-237524395 CTGTCTTCAAGCTGAGGAGCAGG + Intronic
948562551 2:238864284-238864306 GTGTCTTCGAACTGAGGATCAGG - Intronic
948826890 2:240577301-240577323 CTGGCCTCCCTCTGAGGAGCTGG - Intronic
949072768 2:242035988-242036010 CAGTCTGCCCAGTGAGGCGCAGG - Intergenic
1170148229 20:13200789-13200811 CTGCCTTCCCAGTGAGGGGGAGG + Intergenic
1170766383 20:19292898-19292920 CTGTCCTCACACTGAGGAAGGGG + Intronic
1172129791 20:32648001-32648023 CTCTGTGCCCTCTGAGGAGCAGG + Intergenic
1172390804 20:34563758-34563780 CTCACTTCCTCCTGAGGAGCAGG + Intronic
1173108742 20:40164508-40164530 CTGTGTTCCCATTGAGGGGCAGG - Intergenic
1174149001 20:48472933-48472955 CTGTTGTCCCAAGGAGGAGCTGG - Intergenic
1174149064 20:48473350-48473372 CTGTTGTCCCAAGGAGGAGCTGG - Intergenic
1174551680 20:51366898-51366920 CTGAGGTCCCACTCAGGAGCTGG + Intergenic
1176037501 20:63046950-63046972 CTCTCCTGCAACTGAGGAGCTGG + Intergenic
1178422513 21:32453455-32453477 CTGTCTTCCCTCTGGGAGGCAGG - Exonic
1178465029 21:32840317-32840339 CGGTCTTCCCACCAGGGAGCGGG - Intergenic
1178672595 21:34604947-34604969 CTGCCTTCCACCTGAGCAGCAGG + Intronic
1178761087 21:35403537-35403559 ATTTCTTCCCACAGAGTAGCTGG + Intronic
1179048181 21:37865518-37865540 CTGGCTTCTCAAAGAGGAGCTGG - Intronic
1179236098 21:39547780-39547802 CGGTCTTCCCATGGTGGAGCAGG + Intergenic
1179609548 21:42541035-42541057 CAGTCTTTCCACTGGGGACCAGG + Intronic
1180710479 22:17836102-17836124 CTGTCTTCTCACTGAGACACTGG + Intronic
1182045914 22:27274034-27274056 ATTTCTTCCCCCTGAGGAGGAGG + Intergenic
1183060867 22:35335654-35335676 CTGTCCTTCCTCTGGGGAGCAGG + Intronic
1184352178 22:43951753-43951775 CTGTGCTCCCCCTGAGGACCTGG + Intronic
1184638443 22:45855209-45855231 CTGTCTGCAAACTGAGGACCAGG + Intergenic
1184865083 22:47197784-47197806 CTGTCTTTCCACCGAGGTCCAGG + Intergenic
1185192266 22:49446411-49446433 TGGTCTTCCCCCTGCGGAGCTGG - Intronic
952525005 3:34200713-34200735 CTGGCTTTCCACTGAGATGCAGG - Intergenic
952578996 3:34808518-34808540 TTGTCTTCACATTGAGGAGGAGG - Intergenic
954699796 3:52445262-52445284 AGGTCTTCCCAATGGGGAGCTGG - Intergenic
955651038 3:61194117-61194139 CTTTCTTCCCAGTATGGAGCAGG + Intronic
956388466 3:68746237-68746259 CTGTCTGCAAGCTGAGGAGCCGG - Intronic
956780256 3:72597835-72597857 CTGTCCTCCCACGGGGCAGCAGG + Intergenic
957760339 3:84548136-84548158 CTCCCTTCCCACTGCAGAGCAGG - Intergenic
959967840 3:112376409-112376431 CTGTCTGCAAGCTGAGGAGCAGG + Intergenic
961804387 3:129478557-129478579 CGGTCTTCCTCCTGAGTAGCTGG + Intronic
961880082 3:130055755-130055777 CTGTCTTCCCTCTGGGAGGCAGG + Intergenic
962130953 3:132675330-132675352 CTGTCATCACACTGAGGATTTGG - Exonic
962143790 3:132818925-132818947 CTGTCTTCCATCTGATGACCAGG - Intergenic
962316511 3:134362812-134362834 CAGGCTGCCCCCTGAGGAGCAGG + Intronic
962568625 3:136689925-136689947 CTGTCTGCCTCCTGAGTAGCTGG - Intronic
963778743 3:149465651-149465673 GTCTCTTCCCACTGAGCAGCTGG - Intergenic
964157095 3:153599617-153599639 CTGTCTTTCCCCTGAAGTGCTGG - Intergenic
964387469 3:156163948-156163970 CTGTCTTCCAACTGAGGAGTTGG + Intronic
965382115 3:168002817-168002839 CTGTCTTCCAGCAGAGCAGCTGG + Intergenic
966743567 3:183254578-183254600 CTGTCCCGCCACCGAGGAGCCGG - Intronic
968222089 3:196947171-196947193 CAGTCTTCACATTGTGGAGCTGG - Exonic
968575785 4:1365512-1365534 CCCTCCTCCCATTGAGGAGCTGG - Intronic
968841023 4:3005878-3005900 TTCTCTGCACACTGAGGAGCTGG + Intronic
969241903 4:5904489-5904511 CTGAGTTCCTACTGAGGGGCAGG - Intronic
969249945 4:5960705-5960727 CTGACTGCACACTGAGGAGCTGG + Intronic
969967716 4:11014206-11014228 GTGTCCTGCCACTGTGGAGCTGG - Intergenic
970200402 4:13599228-13599250 CTTTCTTCCTGCTGAGCAGCAGG - Exonic
971000797 4:22320125-22320147 ATGTAGCCCCACTGAGGAGCAGG - Intergenic
971796295 4:31233234-31233256 CAGTCTTCTCACTGAGGCGGAGG - Intergenic
972481428 4:39500767-39500789 CTGTCTGCCTTCTGAGTAGCTGG + Intronic
972944497 4:44237365-44237387 GGTTCTTCCCACAGAGGAGCAGG - Intronic
975172346 4:71246548-71246570 CTGTCTTCCCACTTACTACCAGG - Intronic
975351301 4:73350367-73350389 TTCTCTCCCCACTGAGTAGCAGG - Intergenic
976081378 4:81358963-81358985 CTGTCTTCACAGGGAGGAGAAGG - Intergenic
978472739 4:109088282-109088304 ATGTCTCCACAGTGAGGAGCAGG + Intronic
980937812 4:139242797-139242819 CTGTCACCCCACTGATGACCAGG + Intergenic
983656822 4:170091663-170091685 CTGGCTTCCCCCAGTGGAGCCGG - Intronic
984441743 4:179779527-179779549 CTGTTTTCTCTCTGGGGAGCTGG + Intergenic
986291673 5:6404911-6404933 CTGTCTCCCTCCTGAGTAGCTGG - Intergenic
987151683 5:15046956-15046978 CTGTCTGCAAGCTGAGGAGCAGG - Intergenic
988497303 5:31756321-31756343 CTGTCTTCTCTCTGAGGATAAGG + Intronic
990058232 5:51612853-51612875 CAGTCTACCCACAGAGGAGGGGG - Intergenic
991083036 5:62621479-62621501 CTGTCCTCCCACGGAGCAGGCGG + Intronic
991297612 5:65098583-65098605 CTAACTTCCCACTGAGCACCAGG + Intergenic
991594431 5:68288436-68288458 TTGGCTTCTCAATGAGGAGCCGG + Intronic
992751510 5:79867065-79867087 CAGTCTGGCCACTCAGGAGCGGG - Intergenic
994109859 5:95989401-95989423 CTTTCTACTCACTGGGGAGCTGG - Intergenic
994285323 5:97957580-97957602 CTCTCTGCCCACTTAGGTGCTGG + Intergenic
995377144 5:111487821-111487843 CAGTTTTCACATTGAGGAGCTGG + Exonic
996657587 5:125960046-125960068 CTGTCTGCAAGCTGAGGAGCAGG + Intergenic
997295450 5:132765857-132765879 CTGTTTTCCTACTCAGGAGGAGG + Intronic
997673420 5:135694948-135694970 ATGTTTTCTCAGTGAGGAGCTGG - Intergenic
999195547 5:149779234-149779256 TTGTCTTCCCACTGATAAGATGG + Intronic
999398711 5:151248189-151248211 CTCTGCTCCCACTGAGGGGCTGG - Intronic
1000358394 5:160422976-160422998 CTTTCTTCCCTCTGAGTAGAAGG + Intronic
1003095419 6:3139504-3139526 GTGACTTCCCACTGAAGAGGAGG + Intronic
1004779229 6:18887740-18887762 CTGTCTGCAAGCTGAGGAGCAGG - Intergenic
1004869841 6:19893780-19893802 CTGTCTGCACACTGAAGAACCGG + Intergenic
1006153466 6:32001597-32001619 CAGTCTTCCCACCGAGGCCCTGG + Intronic
1006159774 6:32034334-32034356 CAGTCTTCCCACCGAGGCCCTGG + Intronic
1006905732 6:37532192-37532214 CTCTTTTCCCTCTGAGGGGCTGG - Intergenic
1007175028 6:39890203-39890225 TTGTCTTCACGCTGAGGAGGAGG + Intronic
1007783471 6:44267159-44267181 CTCTCACCCCACTGAGTAGCTGG - Intergenic
1008739195 6:54584591-54584613 ATGTCTTACCACAGAGAAGCAGG - Intergenic
1011472647 6:87723230-87723252 CTCTCTTCCAAGTTAGGAGCGGG - Intergenic
1014043095 6:116851723-116851745 ATGTCTTACCACAGTGGAGCAGG - Intergenic
1016234646 6:141848688-141848710 CTGTTTTCTCACTGAGGAGGAGG - Intergenic
1017070652 6:150573129-150573151 CAGTCTTCCGAGGGAGGAGCCGG + Intergenic
1017159108 6:151348979-151349001 CTTTCTTCACAGTGAGTAGCTGG - Exonic
1017528597 6:155265265-155265287 CTGTCTTCTCTCTGAGGGACGGG - Intronic
1017811744 6:157988633-157988655 CGGCCTTCCCACTGAGGATGGGG + Intronic
1018288729 6:162268693-162268715 CTGGCTTCACACTCGGGAGCTGG - Intronic
1020315117 7:6900458-6900480 CTGTCTTCCCTCTGGGAGGCAGG + Intergenic
1022472976 7:30693043-30693065 CTCTCTTGCCACAGAGGAACAGG + Intronic
1024156342 7:46629613-46629635 CTCTGTTCCCACTGAAAAGCTGG + Intergenic
1024980569 7:55154320-55154342 CTGGCTTGCTACCGAGGAGCGGG + Intronic
1024983711 7:55178443-55178465 CTGCCTTCACACAGAGGACCTGG + Intronic
1026449207 7:70512534-70512556 ATGTTTTCCTACTGAGGAGCGGG - Intronic
1026507917 7:71002374-71002396 CTGTCTGCAAGCTGAGGAGCAGG - Intergenic
1027794167 7:82671307-82671329 CTGTCTTCACACTGAGGGTTAGG + Intergenic
1031312473 7:120215913-120215935 CTATCTTCAAGCTGAGGAGCAGG - Intergenic
1032797486 7:135289348-135289370 CTGCCTTCCCACTGAGGTCAAGG + Intergenic
1033324361 7:140365135-140365157 CTCTCCTCCCACTGAGTGGCAGG + Intronic
1033627821 7:143128166-143128188 CTGTACTCCCACTGAGGAGTTGG + Intergenic
1037865520 8:22440106-22440128 CTGTCCTCTCACTGAGTAACTGG - Intergenic
1037933707 8:22900067-22900089 TTGTCTGCAAACTGAGGAGCAGG + Intronic
1038782511 8:30580198-30580220 CTTTCTGCCCTCTGAAGAGCTGG - Intronic
1040012930 8:42677268-42677290 CTGTCTTACCAGTGAGGAAAAGG + Intergenic
1048771528 8:137900734-137900756 CTGTCTTTCCTCTGAAGAGCGGG + Intergenic
1049208981 8:141376659-141376681 CTGTGTTCCCTCTGATGAGCTGG + Intergenic
1049230449 8:141478899-141478921 TTGTTTTCCGACTGAGGAGATGG - Intergenic
1053123244 9:35561169-35561191 CTGTTTCCCCAGTGAGGTGCAGG + Exonic
1056809957 9:89756614-89756636 CTGTTTTCCCACAGAGCTGCAGG - Intergenic
1057904701 9:98974738-98974760 GTGTATTCCCACTGGGGGGCCGG - Intronic
1058107969 9:100996159-100996181 TTGTCTTCCCACACAGGAGCTGG - Intergenic
1059214771 9:112550847-112550869 CTGTCTGACCTCTGAGGAGCTGG - Intronic
1060997468 9:127883238-127883260 CTGTCTGTCCACTGGGGAGGGGG - Intergenic
1061274588 9:129562112-129562134 CTGCCTTCCCACTGCCCAGCTGG - Intergenic
1061898440 9:133660648-133660670 CTATCTGCCCACCGAGGAGAGGG + Intergenic
1062183603 9:135204500-135204522 GTGTCTTCCCACTGCCGTGCAGG + Intergenic
1062375534 9:136260245-136260267 CAGCCCTCCCACTGAGCAGCAGG - Intergenic
1062571043 9:137185519-137185541 CGGTCTTGCCACTGGGTAGCAGG - Intronic
1062571936 9:137189722-137189744 CTGTCCTCACACTCAGGTGCTGG - Intronic
1185474055 X:403213-403235 CTTTCTCCCCACTCAGGAGAGGG + Intergenic
1185708981 X:2287312-2287334 CTGTCTTCCACCTGAGGATTAGG - Intronic
1185840083 X:3381170-3381192 CTGTCTTCACGTTGAGGAGCAGG - Intergenic
1186335755 X:8585505-8585527 CTGTCTTCCCCCTGATAAGAGGG + Intronic
1188800895 X:34528179-34528201 CTGTCTTACCATGGTGGAGCAGG - Intergenic
1196209757 X:112982576-112982598 CTGCCTGCCCCCTGAGTAGCTGG + Intergenic
1196780047 X:119375763-119375785 CTGTCTTCCCACAAAGGATGGGG - Intergenic
1198113323 X:133522080-133522102 TTCTCATCCCACTCAGGAGCTGG + Intergenic
1199845962 X:151693541-151693563 CTTTCCTCCCACTGTGGACCTGG - Intergenic
1200756056 Y:6991078-6991100 CAGTCTGGCCACTGAGCAGCTGG - Intronic