ID: 1141425041

View in Genome Browser
Species Human (GRCh38)
Location 16:83939410-83939432
Sequence AAGGCCAGGTGTTTGCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141425033_1141425041 28 Left 1141425033 16:83939359-83939381 CCTCCTCGTGGATCTAGGTGGCG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1141425041 16:83939410-83939432 AAGGCCAGGTGTTTGCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 229
1141425038_1141425041 -3 Left 1141425038 16:83939390-83939412 CCAGGGTTTGCAGTGAATGAAAG 0: 1
1: 0
2: 2
3: 27
4: 178
Right 1141425041 16:83939410-83939432 AAGGCCAGGTGTTTGCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 229
1141425034_1141425041 25 Left 1141425034 16:83939362-83939384 CCTCGTGGATCTAGGTGGCGTGC 0: 1
1: 0
2: 0
3: 2
4: 28
Right 1141425041 16:83939410-83939432 AAGGCCAGGTGTTTGCAAAGAGG 0: 1
1: 0
2: 0
3: 14
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141425041 Original CRISPR AAGGCCAGGTGTTTGCAAAG AGG Intronic
900307114 1:2015974-2015996 CAGCCCAGGTCTCTGCAAAGTGG + Intergenic
901166243 1:7223612-7223634 GAGGCCCTGGGTTTGCAAAGAGG + Intronic
901554167 1:10018509-10018531 AAAGGTAGGGGTTTGCAAAGGGG - Intergenic
901874781 1:12161318-12161340 AAGGCCAGGTGTTTGTGCTGAGG + Intergenic
903760675 1:25696128-25696150 AAGGAAAGGTCTTCGCAAAGTGG - Intronic
903802316 1:25978389-25978411 AGCGCCAGGTGTATGAAAAGAGG - Intronic
907285437 1:53376747-53376769 AAGGCTAGGAGGTGGCAAAGCGG - Intergenic
907382010 1:54098786-54098808 AAGGGCAGGAGTTTGGATAGGGG + Exonic
908405451 1:63810054-63810076 AAGGCCAGGTGTTTGTGTAGGGG + Intronic
911288739 1:96029004-96029026 ATGGCCAGGTGTGTGCAAACTGG - Intergenic
914342632 1:146773408-146773430 AAGGCATGGTGTTTGCATTGGGG + Intergenic
916126132 1:161572922-161572944 AAAGACAGGTGTTTCTAAAGAGG - Intergenic
916136050 1:161654763-161654785 AAAGACAGGTGTTTCTAAAGAGG - Intronic
916470017 1:165114296-165114318 AAGCGGAGGAGTTTGCAAAGAGG + Intergenic
918202958 1:182284369-182284391 AAGGCCAGGACTTTGAAACGGGG - Intergenic
918909885 1:190554107-190554129 AAGTCCAGGTATTTTAAAAGAGG + Intergenic
921359490 1:214317451-214317473 AAGGCCATGTCTTTGTAATGTGG - Intronic
921691145 1:218152191-218152213 AAGCCCAGGGGCTTGCAATGAGG - Intergenic
921821867 1:219626089-219626111 AAGTCTAAGTTTTTGCAAAGTGG + Intergenic
922152102 1:223015492-223015514 AAGACAAAGTGTTAGCAAAGAGG - Intergenic
922973975 1:229768477-229768499 AACAGCAGGTGTTTCCAAAGAGG - Intergenic
924742487 1:246803229-246803251 AAGGCCAAGGGCTTCCAAAGAGG + Intergenic
1063309819 10:4941579-4941601 AGTGCCAGGTGGTTGGAAAGTGG - Intronic
1063317473 10:5020523-5020545 AGTGCCAGGTGGTTGGAAAGAGG + Intronic
1063844419 10:10110164-10110186 AAGCCCAGGGGTTTGCATATTGG - Intergenic
1064547927 10:16469269-16469291 AAGGGCAGGTGAGTGCAGAGTGG + Intronic
1066950828 10:42113870-42113892 GAGGGTTGGTGTTTGCAAAGGGG + Intergenic
1071304708 10:84288561-84288583 AAGGGAAGATGATTGCAAAGTGG - Intergenic
1071741203 10:88360319-88360341 AAAACCAGGTGCTAGCAAAGAGG - Intronic
1073065136 10:100754056-100754078 AAGGGCAGGTGTTTATAAACAGG + Intronic
1075187072 10:120272285-120272307 AAGTCCAGGTCTTTTCAATGTGG + Intergenic
1075366172 10:121892188-121892210 TAGGCCAAGGGTTTGCCAAGTGG + Intronic
1076544492 10:131236146-131236168 AAGGCTAAGTGTTTGCATATAGG - Intronic
1077366298 11:2162649-2162671 AAGGCTGGGTGTGTGCAGAGCGG - Intergenic
1077445377 11:2588231-2588253 AAGGCCAGGTCTCTCCACAGGGG - Intronic
1078466542 11:11554262-11554284 AAGGCCAGGCTGTGGCAAAGGGG - Intronic
1079310770 11:19363886-19363908 AAGGCAAGGTGTGTGGGAAGGGG + Intronic
1082209093 11:49475705-49475727 AAGTCAAGCTGTTTGCAAGGAGG - Intergenic
1084713250 11:70857352-70857374 AGGAGCAGGTGTTTGAAAAGCGG - Intronic
1085885917 11:80521662-80521684 AAGGCCTGGACTTTGCACAGGGG - Intergenic
1086640525 11:89149525-89149547 AAGTCAAGCTGTTTGCAAGGAGG + Intergenic
1088784047 11:113164661-113164683 AGGGCAAGGTGTGTGGAAAGAGG + Intronic
1088901895 11:114124497-114124519 AAGGCCAGTCATTTGGAAAGGGG + Intronic
1089178458 11:116564710-116564732 AAGGCCTGGTCTTAGCACAGAGG + Intergenic
1089848365 11:121476667-121476689 AAGGGCAGGTGAATTCAAAGTGG - Intronic
1091321420 11:134655033-134655055 AAGTCCTGGAGTTTGCGAAGAGG - Intergenic
1095183735 12:39177462-39177484 AAGGACAAGTGTTTACTAAGTGG - Intergenic
1099813475 12:87616427-87616449 AAGGCAAGCTGTTTTCAATGTGG - Intergenic
1100769394 12:97904916-97904938 AAAGCCATGTGCTTGCCAAGTGG - Intergenic
1101986588 12:109451856-109451878 AAGTCCAGGTGTTGGCAGAGGGG - Intronic
1105446937 13:20465692-20465714 AGGGCCAGGTCTTTGCCAAGAGG - Intronic
1106672348 13:31920019-31920041 AAGGGGAGGTATTTGGAAAGAGG - Intergenic
1107032674 13:35869369-35869391 GAGGCCAGGTCATTGCAAGGAGG + Intronic
1108470114 13:50759102-50759124 AAGGGAATGTGTTTGCAAATTGG - Intronic
1108510906 13:51154942-51154964 TAGGACAGGAGTTTCCAAAGTGG + Intergenic
1109793247 13:67277330-67277352 AAGGAGAGGTGTGAGCAAAGGGG + Intergenic
1110732381 13:78894090-78894112 AATGCCAAATGTTTTCAAAGTGG + Intergenic
1112833771 13:103487804-103487826 AAGGCGAGGTGTATGCACTGTGG + Intergenic
1113508026 13:110830636-110830658 TAGACCAGGTGTTTGCACAACGG - Intergenic
1118050909 14:62026579-62026601 AAATCCAGGTGTTGCCAAAGTGG - Intronic
1119200386 14:72747572-72747594 GAGGCCAGGAGTTTGCAACCAGG + Intronic
1121293304 14:92794821-92794843 AAGGCCAGGCGTCAGCACAGAGG - Intronic
1122214565 14:100194244-100194266 AAGGCCTGGTCTTGGCAATGTGG - Intergenic
1122526943 14:102393268-102393290 ATTGCCAGGTGTTTGGAGAGGGG + Intronic
1125575867 15:40755120-40755142 AAGGCCAGGAGTTTGCAGCCAGG - Exonic
1128147216 15:65338445-65338467 AAGGCCAGGTAACTGCAGAGTGG + Intronic
1128254791 15:66188668-66188690 AAGGCCAGGAGTCTGCATACTGG - Intronic
1130147417 15:81284718-81284740 TAGGCCAGGGGTCTGCAAACTGG + Intronic
1131051042 15:89348116-89348138 AGGGCCAGGTATTTGCCAGGCGG - Intergenic
1131294512 15:91135316-91135338 AATGCCAAGTGTTCTCAAAGGGG - Intronic
1132119505 15:99164762-99164784 AATGCCAGGTGCTTCCCAAGTGG + Intronic
1134129129 16:11636654-11636676 AAGGCCAGGTGTGTTCAACACGG - Intergenic
1136470555 16:30477036-30477058 AAGGTCACATGGTTGCAAAGTGG + Intronic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1139991351 16:70941920-70941942 AAGGCATGGTGTTTGCATTGGGG - Intronic
1140959125 16:79895684-79895706 AAGGCCAGCTGATCTCAAAGTGG - Intergenic
1140961729 16:79919252-79919274 AAGGTCAGATGATTGCAAAGTGG - Intergenic
1141425041 16:83939410-83939432 AAGGCCAGGTGTTTGCAAAGAGG + Intronic
1141708030 16:85680048-85680070 AAGGCCAGGTGGTGCCAGAGAGG - Intronic
1141873738 16:86807158-86807180 AAGGCCAGCTGTTGACAAGGAGG + Intergenic
1141978819 16:87536672-87536694 AAAGGTAGGGGTTTGCAAAGGGG + Intergenic
1143589567 17:7874041-7874063 AAGGCCAGGGGTTTGCAGGAAGG + Intronic
1144067118 17:11634512-11634534 AAGTACAGGTGTGTGCACAGAGG - Intronic
1146629911 17:34462511-34462533 CAGACCAGGGGTTTACAAAGAGG - Intergenic
1148125033 17:45231995-45232017 TAGGCCAGGGGTTTTTAAAGTGG + Intronic
1148615438 17:48997160-48997182 GGGGCCAGGTTCTTGCAAAGGGG + Intergenic
1148624189 17:49056328-49056350 CAGGTCAGGTGTTTGGAATGAGG + Intergenic
1148861283 17:50605608-50605630 TAGGCCAGGCGTGTGCCAAGTGG - Intronic
1151247911 17:72809506-72809528 GAGTCCAGGTGATTGCAAAAGGG - Intronic
1152517626 17:80835147-80835169 AAGGGCATGTTTGTGCAAAGAGG + Intronic
1152734270 17:81989457-81989479 AAGTCCAGGTGTCCGCAGAGTGG + Intronic
1155351372 18:24910684-24910706 ATGTCCAGTGGTTTGCAAAGTGG + Intergenic
1155995918 18:32331697-32331719 TAGGCCAGGAGTTCTCAAAGGGG - Intronic
1156357079 18:36351135-36351157 CAGGACATGTGTGTGCAAAGGGG - Intronic
1157122736 18:44926652-44926674 AAGGGCAGGTGTCTGAGAAGGGG + Intronic
1157173709 18:45431770-45431792 AAGCCCAGTTCTCTGCAAAGAGG - Intronic
1157241985 18:46019285-46019307 AAGGCCTTGTGTTTTCCAAGTGG + Intronic
1158581917 18:58691288-58691310 AAGGCTATGTGGTTGCAAATCGG - Intronic
1158880917 18:61779018-61779040 ATGCCTAGGTGTTTGCAAAGAGG - Intergenic
1160102250 18:75933943-75933965 AAAGCCAGGTCTCTGCAAGGAGG + Intergenic
1161115769 19:2495655-2495677 AGGGCCAGGTGTGGGCAGAGGGG - Intergenic
1161551466 19:4915208-4915230 AAGGGCAGGTCTCTGCAAGGGGG - Intronic
1161980678 19:7628678-7628700 AAGGCCTGGTGTCTGGGAAGAGG - Intronic
1162193095 19:8962514-8962536 AAGGACAGGTGCTTGAGAAGAGG + Exonic
1163454310 19:17397291-17397313 AAGGCCAGGGGTTGGGAATGGGG - Intergenic
1166382810 19:42363483-42363505 GAGGCCAGGGGTTGGGAAAGTGG - Intronic
1166964539 19:46520689-46520711 AAGCCCAGGTGAATGCAGAGAGG - Intronic
925911302 2:8575201-8575223 TAGGCCAGATGTTGGCCAAGGGG + Intergenic
927416337 2:22884721-22884743 AAGGCCAGGAGTTTGGCAAATGG - Intergenic
928160537 2:28920050-28920072 AAGGCCAGGAGTTTGAAACCAGG - Intronic
929027393 2:37617621-37617643 AAGGACAGGTGGTTGCATAAAGG + Intergenic
929905065 2:46038282-46038304 AATGTCAGGTCTTGGCAAAGTGG + Intronic
929960670 2:46493991-46494013 CAGGCTCAGTGTTTGCAAAGAGG + Intronic
932124190 2:69128540-69128562 AAGCCCAGGTGATTGAAAGGGGG + Intronic
933300088 2:80531272-80531294 CAGACCAGGTGTTTACCAAGGGG + Intronic
933488994 2:82960955-82960977 AATGCCAAGTGTTTACTAAGAGG - Intergenic
935045499 2:99478298-99478320 AGGGGAAGGTGTTTGGAAAGTGG - Intronic
935708659 2:105878109-105878131 ATGGCCAAGTGTTTTTAAAGAGG + Intronic
936005101 2:108879320-108879342 AAGTCCAGGTGTTTTACAAGTGG + Intronic
936015958 2:108959226-108959248 AAGGCCAAGTTTGTGCAGAGGGG + Intronic
937325319 2:120986622-120986644 AAGGCCTGGGGTTTGCAGATGGG + Intronic
939011534 2:136852463-136852485 AAGGCATGGTGTTAGCAAGGCGG - Intronic
939390396 2:141561546-141561568 ATGGCCAGGTCATTGTAAAGAGG - Intronic
940115727 2:150206062-150206084 AAGGCCATGTTTTTGCCATGAGG + Intergenic
940493563 2:154395983-154396005 AATTCCAGGTGTTGTCAAAGTGG + Exonic
941388432 2:164881796-164881818 AAGGCCAGTTGTCTGAAGAGGGG + Intergenic
941714620 2:168750752-168750774 TAGGACAAATGTTTGCAAAGAGG + Intronic
942314271 2:174683159-174683181 GAGGACAGGAGTTTGCAGAGGGG + Intergenic
944685215 2:202112090-202112112 AAACTCAGGTGTTTTCAAAGGGG - Intronic
946111741 2:217425717-217425739 AAGGAGATGTGTTTGCATAGGGG - Intronic
947464952 2:230335356-230335378 AAGGCCAAACGTTTCCAAAGTGG - Intronic
947510804 2:230752692-230752714 AAGGCCAGGAGTTGTCAATGGGG - Intronic
1169958484 20:11132110-11132132 AAGGTCAGGGGTTTGGAAGGAGG + Intergenic
1170479555 20:16752613-16752635 AAGGCCAGGTGGGAGCAATGGGG - Intronic
1170727793 20:18945494-18945516 GAGGCCACGTGTCTGCAACGTGG + Intergenic
1171375821 20:24693675-24693697 AAGTCCAGATGTCAGCAAAGAGG + Intergenic
1172861176 20:38053524-38053546 AAGGCCAGGTGCTTTAAGAGAGG + Intronic
1173877017 20:46379456-46379478 AAAGACATGTGTTTGCTAAGGGG - Intronic
1174148452 20:48468909-48468931 CAGACCAGGTATGTGCAAAGAGG + Intergenic
1174920560 20:54697464-54697486 AAAGCAAGGTGGTGGCAAAGAGG + Intergenic
1175673416 20:60926571-60926593 AAGGCCAGTTGTCTGCTAAGGGG - Intergenic
1178940664 21:36902428-36902450 AAGACCAGGTGTCCGCAGAGGGG - Intronic
1180660105 22:17459709-17459731 AAGTTCAGGAGTTTGCAAAGTGG - Intronic
1181378584 22:22480784-22480806 AGGGCAAGGTGTGTGGAAAGAGG - Intergenic
1182088886 22:27580577-27580599 GAGGCCATGTGTGTGCCAAGCGG + Intergenic
1182764928 22:32751672-32751694 AATGCCACTTGTTTGCCAAGAGG + Intronic
1183887225 22:40894343-40894365 AAGGCAAGGTTGTTGCTAAGGGG - Intronic
1184491825 22:44814306-44814328 CAGGGCAGGTGTTGGCCAAGAGG + Intronic
949510879 3:4765717-4765739 ACAGCGTGGTGTTTGCAAAGGGG + Intronic
951495730 3:23323721-23323743 AAGGACAGGAGTTTGCTAAAAGG - Intronic
952636304 3:35536947-35536969 ATGGCCAGCTCCTTGCAAAGAGG + Intergenic
953005190 3:38971387-38971409 CAGGCCAGGTGATCCCAAAGTGG + Intergenic
953664071 3:44913457-44913479 ATGGCCAGGACTTTTCAAAGAGG + Intronic
956884980 3:73550154-73550176 CAGGCCAGTGGTTTTCAAAGTGG + Intronic
957955025 3:87175387-87175409 AACCCCAGGTGTGTGGAAAGGGG + Intergenic
959389395 3:105755628-105755650 AAGCCAGGGTGTTTGCAAACAGG + Intronic
961155897 3:124679316-124679338 AAAACCAGGTGTTTTTAAAGTGG - Intronic
963753197 3:149204009-149204031 TAGGGCAGGTGTATACAAAGAGG + Intronic
966571171 3:181445137-181445159 TTGGCCAGGTGTCTGCAATGTGG - Intergenic
966798266 3:183737293-183737315 AAGGTCAGCTGTATTCAAAGTGG + Intronic
967939289 3:194753989-194754011 GGGTCCAGGTGTCTGCAAAGGGG + Intergenic
969571435 4:8011008-8011030 AAAGCCAGGAGGTTGGAAAGTGG + Intronic
972580549 4:40392026-40392048 GTGGCCAAGTCTTTGCAAAGAGG - Intergenic
972878287 4:43393137-43393159 AAGGCTAGGTATTTACAAAGAGG + Intergenic
973622234 4:52738378-52738400 CAGGGAAGGTGTTTGGAAAGAGG + Intronic
974699926 4:65428574-65428596 AAGGCCAGGTTTTGGTAAAATGG - Intronic
977227287 4:94407665-94407687 AAGGTCTGGGGTGTGCAAAGAGG + Intergenic
977425402 4:96862207-96862229 AAGGCAAGGTCTTTGGAGAGTGG + Intergenic
979979524 4:127237481-127237503 AAGGCCAAGTGTTTGAGATGTGG - Intergenic
980061422 4:128134212-128134234 AAGGCCAGGAGTTTGAAACCAGG - Intronic
981157889 4:141461383-141461405 AAGGTCAGCTGTCTGCAAACTGG + Intergenic
981250485 4:142595398-142595420 AAGGACAGGTGTATTCACAGAGG - Intronic
981535144 4:145792003-145792025 AAGCAGAGGTTTTTGCAAAGAGG - Intronic
982354663 4:154453053-154453075 AAGTCCAGGTCTTGGGAAAGAGG + Intronic
984330900 4:178316490-178316512 CAGGCCAGGTGTTCGCTAACAGG + Intergenic
984508742 4:180653755-180653777 AAAGCCAGGAGTTTGCAGAAAGG + Intergenic
985102371 4:186471147-186471169 AAGGCCACATGTTTCCACAGGGG - Intronic
986621847 5:9684000-9684022 AAGACCAGGTCTGGGCAAAGTGG + Intronic
987136611 5:14905635-14905657 AATGGCAGGTGTTAGCAGAGTGG + Intergenic
989217743 5:38922652-38922674 GGGGCCAGGTGTTTGCAACATGG + Intronic
990485232 5:56251553-56251575 AAGCCCAGGGGCTTGGAAAGGGG + Intergenic
990841590 5:60085850-60085872 AAGGCCATGTTTATGTAAAGAGG + Intronic
997705848 5:135951714-135951736 AAAGACAGCTGTTTTCAAAGTGG - Intronic
999638240 5:153644767-153644789 AAGGAGTGATGTTTGCAAAGAGG + Intronic
999965135 5:156801185-156801207 AAGGCCACGTGTCTCCACAGGGG - Intergenic
1000867617 5:166534519-166534541 AATGGCAAGTGTTTGCAAAGAGG - Intergenic
1005306449 6:24518468-24518490 AAGGCCAGGTGGAGGCAAAATGG + Intronic
1006168727 6:32081103-32081125 GAGTCCAGGTGTTTGGAATGGGG + Intronic
1007170208 6:39857322-39857344 AAGGCCATGTGGTTGGAATGTGG + Intronic
1012838251 6:104296934-104296956 TAGGCCAGATGTTTGCATACGGG - Intergenic
1017071847 6:150582117-150582139 AAGGCAATGTGATAGCAAAGAGG - Intergenic
1017730489 6:157311445-157311467 GAGGCCAGGTGATTGCACACTGG - Intronic
1017730557 6:157311955-157311977 GAGGCCAGGTGATTGCACACTGG - Intronic
1018761913 6:166900469-166900491 AAGGCCAGGTGAACGCACAGGGG + Intronic
1019338590 7:496675-496697 AGGGCCAGGTGGTTGCAAGCTGG - Intergenic
1020115285 7:5472784-5472806 CAGGGCAGGTATTTGCACAGGGG - Intronic
1020365170 7:7373211-7373233 AAGGCCAGGTGTAAAAAAAGTGG - Exonic
1020414975 7:7935159-7935181 AAGGCTAGGGATTTGCAGAGAGG + Intronic
1021739370 7:23670240-23670262 AGGGGTAGGTGTTTGCAGAGTGG + Intergenic
1022216277 7:28265358-28265380 TAAGTCAGGTGTTTGCAAATTGG - Intergenic
1023646293 7:42319306-42319328 AATAACAGGTGTTGGCAAAGAGG - Intergenic
1027831148 7:83179290-83179312 ATGGCAAGGTGTCTTCAAAGAGG + Intergenic
1031738531 7:125398145-125398167 TATGCTAGGTGTTTGGAAAGAGG - Intergenic
1032114284 7:129103686-129103708 AAGGCCAGAGCTTTGCACAGTGG - Intergenic
1032206464 7:129870155-129870177 GAGGCCTGGTGTTTGAGAAGAGG - Intronic
1032268599 7:130384811-130384833 AAGGCAAGTTGCTTGCAAATGGG + Intronic
1033407858 7:141088129-141088151 GAGGCCAGGCTTTTCCAAAGTGG - Intronic
1033572262 7:142642096-142642118 AAGGCTACGTGTCTGCCAAGAGG + Intergenic
1033704930 7:143877181-143877203 AAGTCCAGGTGTCAGCAATGTGG - Intronic
1034268658 7:149792893-149792915 AAGGCCAGGGGTCCCCAAAGAGG - Intergenic
1034513860 7:151558372-151558394 AAAGCCATGTGTGTGCAATGAGG - Intronic
1034859421 7:154583012-154583034 AAGAGCAGGTGTTTGCAGAGAGG - Intronic
1035002197 7:155621994-155622016 AAGGCCAGGAGGATGCAGAGAGG - Intronic
1035338308 7:158144074-158144096 AAGGCCCTGTGTTTCCTAAGGGG + Intronic
1036903899 8:12691692-12691714 CTGGCCAGGTGTTTGTAAACAGG - Intergenic
1036919070 8:12834276-12834298 AAGGCCATGTACTTGGAAAGCGG + Intergenic
1039243678 8:35584319-35584341 ATGGCCATGTGTGTGCTAAGAGG + Intronic
1040652890 8:49469086-49469108 AAGTCAAGGTGTTTGCAGAGCGG - Intergenic
1042027376 8:64438514-64438536 AGGGACAGGTGTTTGCGAAAGGG - Intergenic
1044464926 8:92491761-92491783 AAGACCAGGAGGCTGCAAAGTGG - Intergenic
1046570138 8:115952957-115952979 TAGGCAAGGTGTTTCTAAAGTGG + Intergenic
1046954493 8:120048736-120048758 AGTGCTTGGTGTTTGCAAAGAGG + Intronic
1047337105 8:123946740-123946762 AAGCCCAGGTGTCTGCAACAAGG - Intronic
1047887837 8:129272343-129272365 AAGGCCACATGTTTGCATGGTGG + Intergenic
1053828807 9:42053582-42053604 AAAGCCATGTGTTTGCCAACTGG - Intronic
1054601752 9:67133872-67133894 AAAGCCATGTGTTTGCCAACTGG + Intergenic
1054873385 9:70069985-70070007 AGGGGGAGGTGTTTGCAAAAGGG + Intronic
1057710850 9:97442757-97442779 TAGGCCAGGTGCTTATAAAGAGG - Intronic
1060333963 9:122704219-122704241 AAGGCCATGTGTTAACACAGTGG - Intergenic
1060514763 9:124258625-124258647 AAGGCCTGGTGGGCGCAAAGGGG - Intronic
1186193134 X:7085579-7085601 TAGGTCAGGTATTTACAAAGGGG + Intronic
1187505839 X:19877654-19877676 AAGGGCTGGTGTTTGCATACTGG + Intronic
1189431140 X:40948717-40948739 AAGGTCAGGTGATTGCAAGATGG + Intergenic
1189520656 X:41763738-41763760 ATGACCAGGAGTTTGCCAAGTGG - Intronic
1189645852 X:43130559-43130581 GAGACCAGTTGATTGCAAAGGGG - Intergenic
1190068365 X:47259037-47259059 AAGGACAGGAGTTTGGGAAGAGG - Intergenic
1191241146 X:58190981-58191003 AAGGCCTGGGGTTTGCCAAAAGG - Intergenic
1192146129 X:68684213-68684235 AATGCCTGCTGTTAGCAAAGAGG - Intronic
1194701915 X:97124871-97124893 AAGGTCATGTGTTTGCAGAGGGG - Intronic
1194722691 X:97359058-97359080 AAGACCAGGTGTTTGTAAAAGGG - Intronic
1195929825 X:110063459-110063481 CAGGCCAGGTGTTGGCTGAGAGG + Intronic
1197045729 X:121995817-121995839 AGGGCCAGGTGGTTGCAGATGGG + Intergenic
1199030622 X:142994735-142994757 AAGGCCAGGTGTATGTGAGGTGG + Intergenic
1201492758 Y:14560421-14560443 ATGGCAATGTGTTTGCCAAGGGG + Intronic