ID: 1141425203

View in Genome Browser
Species Human (GRCh38)
Location 16:83940372-83940394
Sequence TCCTTGTCCTGCTGGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 614}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141425193_1141425203 24 Left 1141425193 16:83940325-83940347 CCTACCCACACTCAGTTCCACGG 0: 1
1: 0
2: 0
3: 9
4: 136
Right 1141425203 16:83940372-83940394 TCCTTGTCCTGCTGGGCTCTGGG 0: 1
1: 0
2: 2
3: 56
4: 614
1141425192_1141425203 30 Left 1141425192 16:83940319-83940341 CCTGTGCCTACCCACACTCAGTT 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1141425203 16:83940372-83940394 TCCTTGTCCTGCTGGGCTCTGGG 0: 1
1: 0
2: 2
3: 56
4: 614
1141425195_1141425203 20 Left 1141425195 16:83940329-83940351 CCCACACTCAGTTCCACGGATTG 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1141425203 16:83940372-83940394 TCCTTGTCCTGCTGGGCTCTGGG 0: 1
1: 0
2: 2
3: 56
4: 614
1141425197_1141425203 7 Left 1141425197 16:83940342-83940364 CCACGGATTGACTGCATGTTTGC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1141425203 16:83940372-83940394 TCCTTGTCCTGCTGGGCTCTGGG 0: 1
1: 0
2: 2
3: 56
4: 614
1141425196_1141425203 19 Left 1141425196 16:83940330-83940352 CCACACTCAGTTCCACGGATTGA 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1141425203 16:83940372-83940394 TCCTTGTCCTGCTGGGCTCTGGG 0: 1
1: 0
2: 2
3: 56
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141425203 Original CRISPR TCCTTGTCCTGCTGGGCTCT GGG Intronic