ID: 1141426539

View in Genome Browser
Species Human (GRCh38)
Location 16:83947859-83947881
Sequence CCTGCCAACGTGGAGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141426539_1141426548 13 Left 1141426539 16:83947859-83947881 CCCCAACACTCCACGTTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1141426548 16:83947895-83947917 TGGGGAAACCGAGGCTCAGAAGG 0: 6
1: 32
2: 235
3: 770
4: 1758
1141426539_1141426544 -7 Left 1141426539 16:83947859-83947881 CCCCAACACTCCACGTTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1141426544 16:83947875-83947897 TGGCAGGAGCAGTACACAGATGG 0: 1
1: 0
2: 3
3: 37
4: 366
1141426539_1141426547 4 Left 1141426539 16:83947859-83947881 CCCCAACACTCCACGTTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1141426547 16:83947886-83947908 GTACACAGATGGGGAAACCGAGG No data
1141426539_1141426546 -5 Left 1141426539 16:83947859-83947881 CCCCAACACTCCACGTTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1141426546 16:83947877-83947899 GCAGGAGCAGTACACAGATGGGG 0: 1
1: 0
2: 1
3: 16
4: 254
1141426539_1141426545 -6 Left 1141426539 16:83947859-83947881 CCCCAACACTCCACGTTGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1141426545 16:83947876-83947898 GGCAGGAGCAGTACACAGATGGG 0: 1
1: 0
2: 2
3: 17
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141426539 Original CRISPR CCTGCCAACGTGGAGTGTTG GGG (reversed) Intronic
900247329 1:1642970-1642992 CCTGCCAGCGGGGAGTGAGGTGG - Intronic
900258553 1:1710102-1710124 CCTGCCAGCGGGGAGTGAGGTGG - Intronic
904618530 1:31762642-31762664 CCTGACAACCAGGAGTGTTTGGG + Intronic
917650485 1:177071858-177071880 CCTGAGAAAGTGGAGTGTAGAGG + Intronic
918445912 1:184616792-184616814 CCAGCCAATGTGGAGTTTAGAGG - Intronic
919807033 1:201386326-201386348 ACTGCCAACCTGGAGTGTGACGG + Exonic
920103674 1:203535050-203535072 GCTGCCAAGGTGGGCTGTTGGGG - Intergenic
922698499 1:227744085-227744107 CCTGCCACGGTGGCGTGCTGTGG + Intronic
1062902387 10:1156165-1156187 CCTGGGGATGTGGAGTGTTGGGG + Intergenic
1067258899 10:44668268-44668290 CTTGTCAAGGTGGAGTTTTGAGG - Intergenic
1068543168 10:58318977-58318999 CCTGCCAAGGTGGTGGGCTGGGG + Intergenic
1072622574 10:97089731-97089753 CCTGTCATCGTGGAGGGGTGGGG + Intronic
1074021152 10:109585109-109585131 CCTGCAGATGTGGAGTGATGGGG + Intergenic
1075632137 10:124006760-124006782 CCTCCCACAGTGGTGTGTTGAGG - Intergenic
1076090325 10:127680051-127680073 CCTGCCAAAGTGGCGTATTCTGG - Intergenic
1076870312 10:133189660-133189682 CCTGCCAACGGTGAGTGTGTGGG + Exonic
1079002873 11:16772454-16772476 CCTTCCAAAGTGGAGAGTTAGGG + Intergenic
1085673380 11:78490719-78490741 TCTGCCAGGGTGGAGTGTGGTGG - Intronic
1089130991 11:116211827-116211849 CCTGCCAATGTGGACAGTTGAGG - Intergenic
1098369152 12:69738905-69738927 CCCGCCGCCGTGGAGTGTAGCGG + Intronic
1099657998 12:85520324-85520346 GTTGCCAACGTGGAGTGCAGTGG + Intergenic
1100009264 12:89934453-89934475 CATGCCAACTGGGAGTGATGAGG + Intergenic
1102741781 12:115213849-115213871 CCTGCCAACGTGGGGCTGTGGGG + Intergenic
1111373761 13:87352252-87352274 ACTGCCAAGGAGCAGTGTTGTGG + Intergenic
1119281315 14:73411069-73411091 CCTGCCAGCCTGGAGTGCAGTGG + Intronic
1129102791 15:73281614-73281636 CCTGCCAGCGTGGGATGTTGTGG - Intronic
1138604834 16:58081907-58081929 CCTGCCAAGGTGAAACGTTGAGG + Intergenic
1139504420 16:67391945-67391967 CCTCCCACTGTGGAGTTTTGGGG + Exonic
1141094569 16:81153950-81153972 CCGGCCATCGTGGTGAGTTGGGG - Intergenic
1141426539 16:83947859-83947881 CCTGCCAACGTGGAGTGTTGGGG - Intronic
1156888668 18:42165116-42165138 CCTGCCATCTTGGAGTGCTCTGG + Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1161983725 19:7643281-7643303 CCTGCCAAGGCGGGGTATTGGGG + Intronic
1164294638 19:23899013-23899035 CCTGCCTACATGGAAAGTTGTGG + Intergenic
1166039906 19:40195607-40195629 CCTGCCTACTTGGAAAGTTGAGG - Intronic
1168292601 19:55363842-55363864 CCAGCCAGCCTGGAGTCTTGAGG + Intergenic
925156233 2:1650637-1650659 CCTGGAAAGGAGGAGTGTTGAGG - Intronic
928451845 2:31384882-31384904 CCAGTCAACGCAGAGTGTTGGGG - Intronic
929467351 2:42156941-42156963 CCTGCCCACCTGGGGTGCTGAGG - Intergenic
932064320 2:68537123-68537145 TCTCCCAACCTGGAGTGTGGTGG - Intronic
936289909 2:111215337-111215359 CCTGCCTAAGGGGAGTGTTGGGG + Intergenic
938324163 2:130386571-130386593 CCTGCCACCGTGGAATGTTCTGG - Intergenic
938611146 2:132948792-132948814 CCTGCCAAAGTGGAGGTGTGGGG - Intronic
944541379 2:200756974-200756996 CCTGCCCAAGTGGAGTGCTAGGG + Intergenic
1169056615 20:2627221-2627243 CCTGCCAAGGTGGAGGGTGGTGG - Intronic
1173317684 20:41959823-41959845 CCTAACAAGGTGGAGTGTAGGGG - Intergenic
1175785317 20:61708371-61708393 GCAGCCAACGTGGAGAGTGGAGG - Intronic
1179961707 21:44771043-44771065 CCTCCCTCCCTGGAGTGTTGAGG - Exonic
1181463908 22:23100627-23100649 CCTGCCCTCGTGGTGTGCTGAGG - Intronic
1181558606 22:23686617-23686639 CCTGGTAAGGTGGAGTCTTGAGG - Intergenic
1185277464 22:49955976-49955998 TCTGCCAACCTGGAGAGCTGTGG - Intergenic
951529028 3:23681624-23681646 CCTGTCAACTTTGAGGGTTGGGG + Intergenic
951535813 3:23739641-23739663 CCTGCCAAGCTGCAGTGCTGCGG - Intergenic
952878710 3:37969638-37969660 GCTGGCAACGAGGAGTCTTGTGG + Intronic
962088997 3:132223105-132223127 CCCGCCAGCGTGAAGTATTGTGG + Intronic
965077584 3:163999008-163999030 AATGCCAATGTGGAGTGGTGAGG - Intergenic
969518631 4:7662642-7662664 CCTGACAACGTGGTGTGATGCGG - Intronic
993327487 5:86560124-86560146 CCTGGCAAAATGGAGTGTTCAGG - Intergenic
997709208 5:135989722-135989744 CCTGAGAATGTGGAGTGCTGAGG + Intergenic
1003132025 6:3402809-3402831 CTTGCCATTGTTGAGTGTTGAGG - Intronic
1005425694 6:25700490-25700512 CCTGCCAAGCTGGAAAGTTGTGG - Intronic
1005899740 6:30207014-30207036 CCTGCCCATATGGAGTGCTGTGG + Intronic
1007266588 6:40600891-40600913 TCTACCAAAGTGGAGTGATGTGG - Intergenic
1008224701 6:48900666-48900688 CCTGAGAACCAGGAGTGTTGTGG - Intergenic
1018094765 6:160375493-160375515 ACTGCCAAAGTGGTGTGTAGAGG + Intronic
1019634264 7:2067147-2067169 CCTGCGAACGTGCTGTGTTCGGG - Intronic
1022531176 7:31067880-31067902 GCTGTCATCTTGGAGTGTTGGGG + Intronic
1023552841 7:41388106-41388128 ACTTCCAACATGGAGTCTTGGGG + Intergenic
1023978922 7:45054597-45054619 CCTGCCAGCGTGGAGCTGTGTGG + Intronic
1026509880 7:71019043-71019065 GTTGCCAACCTGGAGTGTAGTGG + Intergenic
1027704957 7:81518789-81518811 CCTGCCAATGTCCAGTTTTGAGG - Intergenic
1029370191 7:100145247-100145269 CTGGCCAACGTGGCCTGTTGTGG - Intergenic
1030260976 7:107563883-107563905 CCTGCCAACATGGAAGGTGGCGG - Exonic
1033202948 7:139390111-139390133 CCTTCCAACCTGGAGTGCAGTGG - Intronic
1034162896 7:149005820-149005842 TCAGGCAAGGTGGAGTGTTGAGG - Intronic
1035597117 8:866889-866911 CCTGGGAACGTGGCATGTTGGGG - Intergenic
1044100062 8:88123912-88123934 CCAGCCTAGGTGGAATGTTGAGG - Intronic
1047853482 8:128884279-128884301 CCTGCCAATGTGTTGTGCTGGGG + Intergenic
1048113112 8:131489073-131489095 CCAGCCAACCTGGAGTGCAGTGG - Intergenic
1049434888 8:142581918-142581940 ACTGCCACCGTGCAGGGTTGGGG + Intergenic
1056463930 9:86835712-86835734 CCTGCCAAAGTTGAGGGGTGTGG + Intergenic
1057928576 9:99173714-99173736 CCTGCCTTCGTGGGTTGTTGTGG - Intergenic
1059960556 9:119560306-119560328 CATGCCAAATTGGAGGGTTGGGG - Intergenic
1060727583 9:126016495-126016517 CCTGCCAGGATGGAGTGCTGGGG + Intergenic
1061059500 9:128243481-128243503 CCTCCCAAGGTGGAGAGTTGGGG - Intronic
1193653565 X:84170125-84170147 CCATCCAAGCTGGAGTGTTGTGG - Intronic
1195753243 X:108177657-108177679 GCTGCCAAAGTGGAATGTTCAGG + Intronic
1196833441 X:119793988-119794010 CCTGCCCTCTTGGAGTCTTGTGG + Intergenic