ID: 1141429180

View in Genome Browser
Species Human (GRCh38)
Location 16:83962151-83962173
Sequence TAGGGTGGCCATGATGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 251}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141429180_1141429188 13 Left 1141429180 16:83962151-83962173 CCTGCCCCATCATGGCCACCCTA 0: 1
1: 0
2: 2
3: 23
4: 251
Right 1141429188 16:83962187-83962209 TGAACCCTGAATATTTGAGATGG 0: 1
1: 4
2: 10
3: 38
4: 204
1141429180_1141429189 14 Left 1141429180 16:83962151-83962173 CCTGCCCCATCATGGCCACCCTA 0: 1
1: 0
2: 2
3: 23
4: 251
Right 1141429189 16:83962188-83962210 GAACCCTGAATATTTGAGATGGG 0: 1
1: 5
2: 70
3: 217
4: 541
1141429180_1141429192 30 Left 1141429180 16:83962151-83962173 CCTGCCCCATCATGGCCACCCTA 0: 1
1: 0
2: 2
3: 23
4: 251
Right 1141429192 16:83962204-83962226 AGATGGGTCTCAGTTAATTTAGG 0: 1
1: 5
2: 33
3: 74
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141429180 Original CRISPR TAGGGTGGCCATGATGGGGC AGG (reversed) Intronic
900250487 1:1666181-1666203 TCTGGAGGCCAGGATGGGGCGGG + Intronic
900410387 1:2510013-2510035 TGGGGGGGCCTTGATGGGGAGGG - Intronic
900603783 1:3514986-3515008 CAGTGTGGGCATGAAGGGGCTGG - Intronic
900917380 1:5648261-5648283 AAGGGTGGCCATGAAGGTCCTGG + Intergenic
901647879 1:10726475-10726497 CAGGCTGGCCAGGCTGGGGCCGG + Intronic
903101694 1:21035650-21035672 GAGAGTGGCCAAGATAGGGCAGG + Intronic
903215152 1:21839606-21839628 GAGGGTGGCCATGGTGAGGAAGG + Intronic
903918333 1:26780576-26780598 TAGTGTGGACATGATGCGGCGGG + Exonic
904601336 1:31674216-31674238 GAGGGTGGCCAGGATGAGGGGGG + Intronic
904686654 1:32265730-32265752 TAGGTTGGAGATCATGGGGCTGG - Intronic
905653312 1:39671011-39671033 TAGGGTGGACCTGTTGGGGAAGG + Intronic
905957656 1:42012399-42012421 TGTGGTCCCCATGATGGGGCTGG + Intronic
905967314 1:42109674-42109696 TAGGGCTGTCATGATGGGACTGG + Intergenic
906722487 1:48019117-48019139 TGGGGTGGCAATGTGGGGGCTGG + Intergenic
909088220 1:71193073-71193095 AAGGATGACCTTGATGGGGCAGG - Intergenic
911722561 1:101207234-101207256 TAGGCCGGGCATGATGGTGCAGG - Intergenic
912524787 1:110273581-110273603 CAGGGTGGCCATCAGTGGGCAGG - Intronic
912547500 1:110461408-110461430 TAGGGTGGCTGTGCTTGGGCAGG + Intergenic
913068163 1:115276219-115276241 AAGGCTGGCCATGATGGGAAGGG + Intergenic
913518345 1:119623622-119623644 GATGGTGGGCATGATGGGGGTGG - Exonic
914764899 1:150629361-150629383 TGGGGAGACCGTGATGGGGCGGG - Intronic
917894308 1:179473252-179473274 TTGGGAGGCCAAGATGGGGGTGG + Intronic
919832903 1:201554514-201554536 TAGGGCGGCCCTGCTGGGGAAGG + Intergenic
920431819 1:205923670-205923692 AAGGGTGCCCCTGCTGGGGCGGG + Intronic
920685374 1:208105157-208105179 GAGGGTGGCCAGGATGGGGTGGG + Intronic
920777988 1:208959078-208959100 TAGAGTGGCCAGGATGTGGGAGG - Intergenic
922045150 1:221938411-221938433 AAGGGTGGCCTTAATGGGACAGG - Intergenic
922783909 1:228273693-228273715 TAGGGTGGCCCTGAAGGGAGCGG + Intronic
922897069 1:229108753-229108775 AAGCGTGTCCATGATGTGGCTGG + Intergenic
923467905 1:234265580-234265602 TTGGGGGGACATGGTGGGGCTGG - Intronic
1063138441 10:3236774-3236796 GAGGGTGGCCTTGCTGGGCCTGG - Intergenic
1063326476 10:5108300-5108322 TTGGGGGGCCGTGGTGGGGCAGG + Intronic
1065325797 10:24549775-24549797 TAGGGAAGCCCTGATGGGGTGGG - Intergenic
1067714941 10:48683629-48683651 AAGGGTGGCCAGCATGGGACAGG - Intergenic
1069598400 10:69687460-69687482 TGGGCTGGACATGGTGGGGCTGG - Intronic
1073036104 10:100565173-100565195 AAGGGTGGCCAGGGTGAGGCTGG + Intergenic
1076898224 10:133324742-133324764 TGGGGTGGGGATGCTGGGGCTGG + Intronic
1076898233 10:133324762-133324784 TGGGGTGGGGATGCTGGGGCTGG + Intronic
1076946324 10:133653624-133653646 TGGGGTGGCCATTATCAGGCGGG + Intergenic
1076996114 11:298337-298359 TTAGGTGCCCATGTTGGGGCTGG + Exonic
1077012747 11:386095-386117 GAGGGAGGCCAAGATGGAGCTGG + Intergenic
1077305887 11:1868551-1868573 TGGGCTGGCCCTGAGGGGGCTGG + Intronic
1078582808 11:12551812-12551834 CTGGGTGCCCATAATGGGGCAGG + Intergenic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1079990256 11:27239233-27239255 TAGAGTAGGCATGATGGGGAGGG - Intergenic
1081599799 11:44485157-44485179 TAGGCTGGCGATGTTAGGGCTGG - Intergenic
1081625767 11:44654250-44654272 GGGAGTGGCCATGCTGGGGCGGG - Intergenic
1083882138 11:65553981-65554003 TAGGGTGGCCAGGGCAGGGCAGG - Intronic
1084485118 11:69443616-69443638 CACGGCGGCCGTGATGGGGCTGG - Intergenic
1084495303 11:69500009-69500031 GAGGTTGGCCAGGAAGGGGCAGG - Intergenic
1084779256 11:71397771-71397793 CAGGGTGGCCCTGATGGGGCTGG - Intergenic
1085315905 11:75544841-75544863 TTGGGTGGGCTTGGTGGGGCAGG - Intergenic
1089494281 11:118900547-118900569 CAGTGTGTCCATGCTGGGGCTGG - Intronic
1090886160 11:130878632-130878654 TAGGGTGTCGGTGATGGGGGAGG - Intronic
1093308401 12:17547377-17547399 ATGGGTGGCCATGAGGGTGCTGG + Intergenic
1093707992 12:22296450-22296472 GAGGGTGGGCTTGACGGGGCTGG - Intronic
1095179105 12:39126676-39126698 TAGGGTGTCCATGACCGAGCTGG - Intergenic
1095200019 12:39372981-39373003 TAGGGTGGTGTTGATGGGGGAGG - Intronic
1095447729 12:42299099-42299121 TAGGGTGGCTGTGGTGGGGGAGG + Intronic
1096117897 12:49066427-49066449 TAGTGTGGGCATGAGGGGGTGGG - Intronic
1098051112 12:66454204-66454226 TAGGGTGGCCCTGGTGAGACTGG + Intronic
1098597838 12:72294611-72294633 TTGGGTGGCCATGGTTGGGCCGG + Intronic
1099861278 12:88228423-88228445 CAGGGTGGCTATGATGGAGAAGG - Intergenic
1102460425 12:113096612-113096634 TAAGGTAGCCATGATGTGGCAGG + Intronic
1102601344 12:114032994-114033016 TAGGGAGGCAATGCAGGGGCTGG - Intergenic
1104358639 12:128111601-128111623 AAGGGTGGCCGTGTTGGGCCTGG + Intergenic
1104657591 12:130585196-130585218 AATGGTAGCAATGATGGGGCTGG - Intronic
1104904977 12:132208293-132208315 TAGTGTGGCCAGGAAGGGGAGGG - Intronic
1105295520 13:19085549-19085571 GGGGGAGGCCATGCTGGGGCTGG + Intergenic
1113750442 13:112773222-112773244 GAGGGTGGCGATGGTGGGGCAGG - Intronic
1113902591 13:113805077-113805099 TGGGATGGACAGGATGGGGCTGG + Intronic
1114252939 14:20977119-20977141 TTGGGAGGCCAAGGTGGGGCAGG - Intergenic
1117036961 14:51739998-51740020 TAGGGTGGCTTTGGTGGGGAGGG - Intergenic
1117559654 14:56923698-56923720 TAGGGCCCCCATGATGGGACTGG + Intergenic
1118442315 14:65822936-65822958 TAGGGTGGTCAGGGTGGGCCTGG - Intergenic
1118877269 14:69796169-69796191 CAGGGTGGCTGAGATGGGGCTGG + Intronic
1120255635 14:82115911-82115933 TAGGGCCCCCATGATGGGACTGG + Intergenic
1121411960 14:93754422-93754444 TAGGGGGGCCATGGTGGGGGGGG + Intronic
1121928058 14:97947340-97947362 TGGGGTGGCCTGGATGTGGCTGG - Intronic
1122152751 14:99733533-99733555 CACGGTCACCATGATGGGGCAGG - Intergenic
1122429154 14:101628993-101629015 CAGGGTGGCCATCATGGAGTGGG + Intergenic
1202920432 14_KI270723v1_random:26250-26272 TGGGGTGGCCATTATCAGGCGGG + Intergenic
1202924499 14_KI270724v1_random:11397-11419 TAGGGTGGCCATTATCAGGCGGG - Intergenic
1125143131 15:36433198-36433220 TAGGCTGGGCATGGTGGGCCAGG - Intergenic
1126893732 15:53235703-53235725 TAGTGTGGCTATGAGGGGGTAGG - Intergenic
1128238130 15:66081213-66081235 CAGGGTGGCCATGAGCGGGGTGG + Intronic
1129152389 15:73697126-73697148 CAGGGTGGCCCTTGTGGGGCAGG + Intronic
1129262164 15:74374484-74374506 TTGGCTGGCCATGAGGGGGCGGG + Intergenic
1129670693 15:77606194-77606216 TGGGGTGGCCAGGGTGGGGCAGG + Intergenic
1130196074 15:81781405-81781427 AATGGTGGCCAGGATGTGGCTGG - Intergenic
1130394084 15:83486943-83486965 TAGGGACCCCATGATGGGGCCGG - Intronic
1131501944 15:92976571-92976593 TTGGGAGGCCAAGATGGGGGAGG + Intronic
1132504728 16:302077-302099 TGGGGTGGCCCTGAGGAGGCTGG - Intronic
1132882136 16:2167172-2167194 GAAGGTACCCATGATGGGGCAGG + Intronic
1133305130 16:4803771-4803793 TAGGGTGGCCACACTAGGGCGGG - Exonic
1134608051 16:15586760-15586782 CACGGTGGCCAAGACGGGGCTGG + Exonic
1134787932 16:16961894-16961916 TACAGTGCCCACGATGGGGCAGG - Intergenic
1135674163 16:24401288-24401310 TATGGTACCCATGATGGGGGGGG - Intergenic
1136101452 16:27999519-27999541 TAGAGTTCCCATGATGGGCCAGG - Intronic
1137023338 16:35451634-35451656 TGGGGTGGCGAGGTTGGGGCTGG - Intergenic
1137023356 16:35451711-35451733 TGGGGTGGCGAGGTTGGGGCTGG - Intergenic
1140253600 16:73316367-73316389 TGGGGTGGACATAAAGGGGCAGG - Intergenic
1141429180 16:83962151-83962173 TAGGGTGGCCATGATGGGGCAGG - Intronic
1142192358 16:88723719-88723741 TTGGGAGGCCTGGATGGGGCGGG + Intronic
1143105750 17:4529947-4529969 ATGGGTGGCCAGGGTGGGGCTGG + Intronic
1144061158 17:11583933-11583955 GGGGGCTGCCATGATGGGGCTGG - Intergenic
1144954728 17:19013338-19013360 TGGGGTGGGCAAGATAGGGCTGG - Intronic
1146150270 17:30462660-30462682 TAGGGTCTCCTTGATGGAGCTGG - Intronic
1147366606 17:39963311-39963333 TGGGAGGGCCAGGATGGGGCAGG - Intronic
1147997168 17:44366622-44366644 TATGGTGGCCAAGAGGGGACTGG + Intergenic
1148635248 17:49144181-49144203 TAGGGACCCCATGATGGGACTGG - Intronic
1148804937 17:50259261-50259283 AAGGGTGGCCAGGAGAGGGCAGG + Intergenic
1149553017 17:57554006-57554028 TAGGGAGCCCATAAAGGGGCAGG - Intronic
1150050705 17:61959308-61959330 AAGAGGGGCAATGATGGGGCTGG - Intronic
1151685510 17:75643875-75643897 TGGGGTGGGCATGAAGAGGCTGG - Intronic
1151715491 17:75829010-75829032 TGGGGTGGCTGTGCTGGGGCTGG - Intronic
1151787195 17:76280797-76280819 CAGGGTGGCTGGGATGGGGCCGG - Intronic
1152229766 17:79108647-79108669 CAGGGTGGCCGTGCTGGGGGCGG - Intronic
1152333110 17:79684963-79684985 TAGGGTGTCCCTCCTGGGGCAGG - Intergenic
1152564175 17:81092821-81092843 CACGGTGGACATGCTGGGGCAGG + Intronic
1152635715 17:81429784-81429806 TAGGTAGGCCAGGGTGGGGCAGG + Intronic
1152706262 17:81845154-81845176 AGCGGTGGCCAGGATGGGGCAGG - Exonic
1153164134 18:2242937-2242959 TAGGGACGCCATCATTGGGCCGG + Intergenic
1156307813 18:35895205-35895227 TAGGTTCTCCATGATGGGACTGG + Intergenic
1160996022 19:1882193-1882215 TAGGGTGGCAGAGATGGGCCGGG - Intronic
1161301544 19:3545178-3545200 CAGGCGGGCCATGCTGGGGCTGG - Intronic
1161420939 19:4175640-4175662 CAGGGAGCCCATGGTGGGGCGGG - Intronic
1161633219 19:5369963-5369985 CAGGCAGGCAATGATGGGGCTGG - Intergenic
1161994801 19:7705657-7705679 TGGGAAGGACATGATGGGGCCGG - Intergenic
1161998869 19:7730885-7730907 GAGGGCGGCGAGGATGGGGCGGG + Intronic
1162007301 19:7788748-7788770 GAGGGAGGCGAGGATGGGGCGGG - Intergenic
1162745318 19:12794459-12794481 CAAGGTGGCAATGATGGGGCAGG + Intronic
1163338002 19:16686284-16686306 CAGGCTGGCCTTGGTGGGGCTGG - Exonic
1164797702 19:31047468-31047490 TAGGATGGCCATGATGACCCTGG + Intergenic
1164862043 19:31569278-31569300 TGGGGTGGTGATGATGGGGGAGG - Intergenic
1165259091 19:34597694-34597716 AACGGTGGCCATGAGGGTGCAGG - Intronic
1165396520 19:35567178-35567200 CAGGGTGGACATGGTGGGGAGGG + Intergenic
1165507110 19:36240570-36240592 TAAAATGGCCATGAAGGGGCTGG + Intronic
1165859388 19:38899411-38899433 AAGGGTGGCCGCGGTGGGGCGGG - Intronic
1166383605 19:42368602-42368624 TGGGGGGGCCAGGATGGGGGTGG + Exonic
1167578222 19:50327945-50327967 TAGGGTGGCCTTGGCGGGGGAGG + Intronic
1167694793 19:51009150-51009172 CAGGCTGGCCATGCTGGGGAGGG - Intronic
1168487074 19:56772551-56772573 TTGGGAGGCCAAGGTGGGGCGGG + Intergenic
926957716 2:18319717-18319739 TAGAGTGACCATGATGGGCTAGG + Intronic
927427530 2:22997312-22997334 TAGGGCCCCCATGATGGGACTGG + Intergenic
931224301 2:60316409-60316431 AAGGGGGGCCATGCTGGGGAGGG - Intergenic
932010878 2:67976307-67976329 TGGGGTGGCCATGATTGGTCAGG - Intergenic
932861852 2:75302369-75302391 TATGGTGGCCATGAGGGCCCAGG - Intergenic
932878097 2:75474219-75474241 TAGGGTGGCCAGGAGGGGAACGG + Intronic
934628399 2:95885886-95885908 TCGGGTGACCCTGATGGTGCTGG - Intronic
934832356 2:97541749-97541771 TCGGGTGACCCTGATGGTGCTGG - Intronic
935191952 2:100785155-100785177 CAGGGTGGCCATCAGGGTGCAGG - Intergenic
937534633 2:122871084-122871106 TATGCTGGCCATGGTGGGCCAGG - Intergenic
937814105 2:126232031-126232053 TAGGGAGGACATGAAGGGGAGGG - Intergenic
938427478 2:131203262-131203284 TAGGGTGGCCGGGTAGGGGCTGG - Intronic
942786968 2:179711027-179711049 TAGGCTGTACATGATGGGACAGG + Intronic
944098627 2:195997308-195997330 CAGGTTGGCCAGGATGGGTCCGG - Intronic
946016309 2:216606822-216606844 AAGGGGGGCCAGGAGGGGGCCGG - Intergenic
947479339 2:230483598-230483620 TAGGAGGGCAAGGATGGGGCAGG + Intronic
948167107 2:235871417-235871439 TGGGGTGGCCGGGAGGGGGCAGG + Intronic
948465437 2:238149682-238149704 CAGGGTGGCCAAGTTGGGGAGGG + Intronic
948785469 2:240350169-240350191 AAGGGTGGCCAGGATGGGGCAGG + Intergenic
948792828 2:240388163-240388185 GAGGGAGGCCAGGATGGGTCAGG - Intergenic
1170944599 20:20879857-20879879 GGGGGAGTCCATGATGGGGCAGG + Intergenic
1171727502 20:28638712-28638734 CAGGCAGGCCATGAAGGGGCAGG + Intergenic
1171750613 20:29044986-29045008 CAGGCAGGCCATGAAGGGGCAGG - Intergenic
1171750728 20:29045904-29045926 CAGGCAGGCCATGAAGGGGCAGG - Intergenic
1172613447 20:36267941-36267963 CAGGGTGGCCATGCTGGAGGTGG - Intronic
1172898697 20:38318537-38318559 CAGGGTGGATGTGATGGGGCCGG + Intronic
1174250202 20:49213700-49213722 TAGGGTGGCATTGGTGAGGCTGG - Intergenic
1174835576 20:53853439-53853461 TAGGGTGGGGACCATGGGGCTGG + Intergenic
1175709291 20:61206314-61206336 TGTGGTGGCCCTGATGGGGTTGG - Intergenic
1175823397 20:61923953-61923975 GAGTGTGGCCAGGATCGGGCCGG - Intronic
1176314032 21:5225018-5225040 CAGGCAGGCCATGAAGGGGCAGG + Intergenic
1178272017 21:31199465-31199487 GAGGGTGGCCATGGTGGAGGTGG - Intronic
1178493322 21:33067957-33067979 GGAGGGGGCCATGATGGGGCGGG - Intergenic
1178679441 21:34660153-34660175 TCAGGTGCCAATGATGGGGCAGG - Intergenic
1179633219 21:42691429-42691451 GATGGTGACGATGATGGGGCTGG - Intronic
1179881814 21:44296210-44296232 CTGCGTGGGCATGATGGGGCTGG - Intronic
1180070218 21:45432170-45432192 CAGGGAGGCCCTGCTGGGGCAGG - Intronic
1180163321 21:46007536-46007558 AAGGGTGGCTGTGATAGGGCAGG - Intergenic
1180190092 21:46158813-46158835 GAGGGTGGCCCTGAAGTGGCTGG - Intergenic
1180211161 21:46296093-46296115 TGGGGTGGCCCTGAAGGGGCAGG + Intronic
1180754576 22:18152133-18152155 TGTGGTTGCCATGATGGGGTGGG + Intronic
1182115555 22:27754400-27754422 CAGGGTGGCCCTGCTGGGGTGGG - Intronic
1182376599 22:29853089-29853111 TATGGTGGCCCTGAAGTGGCTGG + Intergenic
1182515630 22:30857230-30857252 GAGGGAGGCAATGATGGGCCTGG + Intronic
1183650338 22:39150023-39150045 TAGGGAGGGCAGTATGGGGCGGG - Intronic
1183844576 22:40530591-40530613 TAAGATGGACATTATGGGGCCGG - Intronic
1184459683 22:44630002-44630024 CTGGGTGGCCCTGATGTGGCTGG + Intergenic
1185214301 22:49589765-49589787 GAGGGTGGCCATGTGGGGCCTGG + Intronic
952288080 3:31987591-31987613 TAGGCTGGCCATGTTTGAGCTGG + Intronic
952765548 3:36950712-36950734 TTGGGAGGCCAAGGTGGGGCGGG + Intergenic
953361470 3:42301003-42301025 TGGGGTGGTCATGAAGGGGTCGG + Intergenic
953947309 3:47160848-47160870 GTGGGTGTCCATTATGGGGCAGG - Intronic
954146779 3:48638360-48638382 TGGAGTGGGCATGAAGGGGCTGG - Intronic
954149055 3:48648211-48648233 CAGGGGGGCCATGAAAGGGCAGG - Intronic
954431683 3:50474042-50474064 TAGGGTGGACAAGATGAGCCTGG - Intronic
955209567 3:56928253-56928275 TAAGGTGGCAATGATGTGGCAGG - Intronic
957081152 3:75636837-75636859 TGGGGTGGCCATTATCAGGCGGG - Intergenic
961380870 3:126495859-126495881 CAGTGTGGCCACCATGGGGCTGG + Intronic
961558486 3:127712741-127712763 AAGGGTGGCCGTGATGGGTCAGG + Intronic
962236149 3:133709362-133709384 TATGGTGGCTATGCTGGAGCTGG - Intergenic
962758987 3:138491968-138491990 GGTGGTGGCCATGGTGGGGCAGG - Intergenic
963995288 3:151701756-151701778 TAGGGTCTCCATGATCGAGCTGG + Intergenic
964135494 3:153340687-153340709 TAGGGTCCCCATGACGGAGCTGG + Intergenic
966920372 3:184607322-184607344 GAGGGTCACCATGGTGGGGCAGG + Intronic
967121287 3:186385040-186385062 GAGAGTGGCCATGATGGTGTTGG + Intergenic
968234091 3:197021556-197021578 AGGGGTGGCCATGATGGGCATGG + Intronic
968422776 4:499323-499345 TAGCGTGTCCACGATGCGGCTGG + Exonic
968599679 4:1503064-1503086 CAGGGTGGCCGTGATGGGTTCGG + Intergenic
968703930 4:2069496-2069518 TGGGGTGGCAAAAATGGGGCGGG - Intergenic
969592542 4:8130225-8130247 CAGGGTGGCCAGGGTGGTGCTGG + Intronic
971938975 4:33189434-33189456 GAGGGCTGCCAGGATGGGGCTGG - Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
978491359 4:109315013-109315035 TAGGGAGGACATGATGGACCAGG - Intergenic
985433091 4:189900334-189900356 CAGGCAGGCCATGAAGGGGCAGG - Intergenic
985449738 4:190054277-190054299 TGGGGTGGCCATTATCAGGCGGG + Intergenic
986345036 5:6826973-6826995 TAGGATGGGCATGGTGGGGAGGG - Intergenic
986400166 5:7372085-7372107 TAGGGTGGTGATGATGGTGGTGG - Intergenic
989041889 5:37237895-37237917 TAGGCTGGGCATGATGGCTCAGG + Intronic
994857683 5:105145235-105145257 TTGGGAGGCCAAGGTGGGGCGGG + Intergenic
996133950 5:119816137-119816159 TGGGCTGGGCAGGATGGGGCAGG - Intergenic
1001034561 5:168288384-168288406 GAGGGTGGCCAGGAGAGGGCTGG + Intergenic
1001384775 5:171329730-171329752 TCTGGTGGCCTTGAGGGGGCAGG + Intergenic
1002441493 5:179266753-179266775 TGGGGGGCCCAGGATGGGGCAGG - Intronic
1002449222 5:179309513-179309535 TTGGGAGGCCAAGGTGGGGCGGG + Intronic
1002861181 6:1080675-1080697 TGGGGTGGCCAGGCAGGGGCTGG - Intergenic
1003040759 6:2685429-2685451 TAGTGTGGTCAAGATGGGGCGGG + Intronic
1005868795 6:29957856-29957878 AACGATGCCCATGATGGGGCTGG - Intergenic
1006763734 6:36486535-36486557 TAGGGTAGCCATGCTTTGGCAGG + Intronic
1007275780 6:40672662-40672684 TGGGGTGGCCTTCCTGGGGCAGG - Intergenic
1007745216 6:44039395-44039417 TGCGCTGGCCATGGTGGGGCTGG + Intergenic
1009642888 6:66361172-66361194 TAGGGTCTCCCTGATGGAGCTGG + Intergenic
1009933386 6:70203563-70203585 TACGGTGGGCATGGTGGGGGTGG - Intronic
1011227803 6:85127017-85127039 CAGTGTGGCCACCATGGGGCTGG + Intergenic
1014447027 6:121540402-121540424 GAGGCTGGGCATGATGGGTCAGG + Intergenic
1016876555 6:148871054-148871076 TAGGGCTGCCATGATGGGATTGG + Intronic
1017499954 6:155015045-155015067 TAGGGTGTGCATGCTGGAGCTGG + Intronic
1018925574 6:168204387-168204409 CAGGGAGGCCCTGACGGGGCAGG + Intergenic
1019290156 7:246284-246306 CAGGGTGGCCCTGAGGAGGCTGG + Intronic
1019512337 7:1424022-1424044 GAGGGTGGGCGGGATGGGGCTGG - Intergenic
1022442575 7:30446310-30446332 TACGGTTCCCAAGATGGGGCTGG - Intronic
1022625962 7:32036246-32036268 TAGGATGGATATGCTGGGGCAGG - Intronic
1023448319 7:40254975-40254997 TTGGGAGGCCAAGGTGGGGCGGG + Intronic
1026981682 7:74530306-74530328 TGGGGAGGCAATGATGGGGCAGG + Intronic
1031987147 7:128170542-128170564 AAGGCTGGCCAAGATCGGGCAGG + Intergenic
1033864445 7:145671860-145671882 TATGGTGGCCATCAGTGGGCTGG + Intergenic
1034787191 7:153936347-153936369 TGGAGCGGCCAGGATGGGGCTGG + Intronic
1037714063 8:21382084-21382106 TAGGGCCACCATGATGGGGCTGG - Intergenic
1037939280 8:22939667-22939689 CATGGTGGCAATGATGGGGCTGG + Intronic
1043195656 8:77288435-77288457 CATGCTGGCCATGGTGGGGCGGG - Intergenic
1047351493 8:124078765-124078787 TAGGGAGGACGTGATGTGGCAGG + Intronic
1048198920 8:132355332-132355354 CAGGGTGGCTGTGATGGTGCTGG - Intronic
1049351145 8:142165464-142165486 TAGGGAGGCCTGGATGGGGGTGG - Intergenic
1049748726 8:144273745-144273767 TGAGGTGGCCATGCGGGGGCGGG + Intronic
1051844309 9:21434355-21434377 TAGGGTCGCCCTGACCGGGCTGG + Intronic
1051874513 9:21777251-21777273 TAGGGTGAACATGATGGGGTTGG + Intergenic
1052652377 9:31321306-31321328 ATGGGTGGCCATGGTGGGCCTGG + Intergenic
1052707254 9:32008765-32008787 TAAGGAGGCCATGCTGGAGCTGG - Intergenic
1052960212 9:34289259-34289281 TAGGGAGACCATGATAGGGCAGG - Intronic
1053464503 9:38295821-38295843 GAGGGTGGGCAAGATGGTGCAGG - Intergenic
1053722239 9:40958386-40958408 CAGGCAGGCCATGAAGGGGCAGG - Intergenic
1055447142 9:76394545-76394567 GGGCGGGGCCATGATGGGGCGGG - Intergenic
1058510520 9:105712837-105712859 TGGGGTCTCCACGATGGGGCTGG + Intronic
1062027637 9:134347802-134347824 TCTGGTGGCCAGGAGGGGGCTGG + Intronic
1062448296 9:136604885-136604907 AAGGGTGGCCTGGGTGGGGCTGG - Intergenic
1062610563 9:137371586-137371608 TAAGGGGGCCCTAATGGGGCGGG + Intronic
1062658864 9:137618281-137618303 GAGGGTTGCCCTGATGGGGGAGG - Intronic
1203452937 Un_GL000219v1:137593-137615 CAGGCAGGCCATGAAGGGGCAGG + Intergenic
1187135246 X:16541868-16541890 TATAGAGGCCATGATGGGGCTGG + Intergenic
1190056960 X:47186628-47186650 TTGGGTGTCCATCCTGGGGCAGG + Exonic
1197271070 X:124425452-124425474 TGGGGTCCCCATGATGGGACTGG + Intronic
1197796037 X:130299558-130299580 GAGGGAGGCCAAGATGGGGCTGG - Intergenic
1198024894 X:132695193-132695215 TAGGGTGGGCATGATGTGTGAGG - Intronic
1198224210 X:134630587-134630609 AAGGGCGGGCAAGATGGGGCAGG + Intronic
1199738277 X:150706184-150706206 TAGGGCTTCCATGATGGGACTGG - Intronic