ID: 1141430389

View in Genome Browser
Species Human (GRCh38)
Location 16:83968132-83968154
Sequence AGTTAAGGATGGGCGCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141430380_1141430389 3 Left 1141430380 16:83968106-83968128 CCTGAGGGGGCGTGCACGCCCGC No data
Right 1141430389 16:83968132-83968154 AGTTAAGGATGGGCGCCCGCGGG No data
1141430379_1141430389 15 Left 1141430379 16:83968094-83968116 CCAAGGGGGCGGCCTGAGGGGGC No data
Right 1141430389 16:83968132-83968154 AGTTAAGGATGGGCGCCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141430389 Original CRISPR AGTTAAGGATGGGCGCCCGC GGG Intergenic
No off target data available for this crispr