ID: 1141435473

View in Genome Browser
Species Human (GRCh38)
Location 16:83997364-83997386
Sequence CCCTGCTTGGGACCACCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 158}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141435464_1141435473 -8 Left 1141435464 16:83997349-83997371 CCCTGACCCCGCTCTCCCTGCTT 0: 1
1: 0
2: 0
3: 29
4: 374
Right 1141435473 16:83997364-83997386 CCCTGCTTGGGACCACCAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 158
1141435465_1141435473 -9 Left 1141435465 16:83997350-83997372 CCTGACCCCGCTCTCCCTGCTTG 0: 1
1: 1
2: 1
3: 30
4: 483
Right 1141435473 16:83997364-83997386 CCCTGCTTGGGACCACCAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 158
1141435459_1141435473 24 Left 1141435459 16:83997317-83997339 CCAGGACTGCCAAGATCCAAGTG 0: 1
1: 0
2: 2
3: 6
4: 137
Right 1141435473 16:83997364-83997386 CCCTGCTTGGGACCACCAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 158
1141435462_1141435473 8 Left 1141435462 16:83997333-83997355 CCAAGTGGCTCAATGCCCCTGAC 0: 1
1: 0
2: 2
3: 11
4: 109
Right 1141435473 16:83997364-83997386 CCCTGCTTGGGACCACCAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 158
1141435461_1141435473 15 Left 1141435461 16:83997326-83997348 CCAAGATCCAAGTGGCTCAATGC 0: 1
1: 0
2: 0
3: 9
4: 162
Right 1141435473 16:83997364-83997386 CCCTGCTTGGGACCACCAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 158
1141435458_1141435473 29 Left 1141435458 16:83997312-83997334 CCATGCCAGGACTGCCAAGATCC 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1141435473 16:83997364-83997386 CCCTGCTTGGGACCACCAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 158
1141435457_1141435473 30 Left 1141435457 16:83997311-83997333 CCCATGCCAGGACTGCCAAGATC 0: 1
1: 0
2: 0
3: 3
4: 132
Right 1141435473 16:83997364-83997386 CCCTGCTTGGGACCACCAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 158
1141435463_1141435473 -7 Left 1141435463 16:83997348-83997370 CCCCTGACCCCGCTCTCCCTGCT 0: 1
1: 0
2: 5
3: 62
4: 546
Right 1141435473 16:83997364-83997386 CCCTGCTTGGGACCACCAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141435473 Original CRISPR CCCTGCTTGGGACCACCAGG AGG Intronic
900288063 1:1911235-1911257 CCCTGGTGGGGACATCCAGGTGG - Intergenic
900371768 1:2335424-2335446 GCCTGCCTGGGACCAACACGGGG - Intronic
902553088 1:17230708-17230730 CCCTGGTTGGGTCCTCCTGGAGG + Intronic
903264994 1:22152834-22152856 CGCAGCTTGGGGCCTCCAGGAGG + Intergenic
904782828 1:32963957-32963979 CCCTGCTTGGGACACCCACGCGG + Intronic
909510638 1:76448214-76448236 CCCTGCTGGGGACTTCCATGGGG + Intronic
912207347 1:107523243-107523265 CCCAGCTTAGGAACAGCAGGGGG - Intergenic
912796283 1:112695523-112695545 CCCTGCTGGGGGCCAGGAGGCGG - Exonic
915817035 1:158978868-158978890 TCCTACTTGGGACCACAAGTAGG + Intergenic
916122877 1:161544558-161544580 CCCTCCTGGTGATCACCAGGAGG - Intronic
916132781 1:161626002-161626024 CCCTCCTGGTGATCACCAGGAGG - Intronic
920213527 1:204346000-204346022 CCCTGCTAGCCACCACCAGATGG + Intronic
921757946 1:218881368-218881390 CTCTGCTTGGGATCACGAGATGG - Intergenic
922665360 1:227464442-227464464 CCCTGCTTGGAACCACCACTCGG - Intergenic
1067827982 10:49593215-49593237 TTCTGCCTGGCACCACCAGGGGG + Intergenic
1069552490 10:69374331-69374353 CCCTTCCTGGGCCCACCAGCAGG + Intronic
1069625909 10:69867545-69867567 CCCTGCTGGGGACCTGCCGGTGG - Intronic
1075131264 10:119741931-119741953 AGCTACTTGGGAGCACCAGGTGG - Intronic
1077014201 11:392743-392765 CCCGGGCTGGGGCCACCAGGTGG - Intronic
1078561532 11:12377396-12377418 CCCTGCTTGGGGCAACCCAGGGG + Exonic
1079007115 11:16799862-16799884 CCCTGCCTAGGACCACGTGGAGG - Intronic
1084695948 11:70755697-70755719 CCCTGCTTGTGGCCACTAGATGG - Intronic
1084734434 11:71095179-71095201 CCCAGATTGGGAGCTCCAGGGGG - Intronic
1087094648 11:94307337-94307359 CCCTTGTGGGGACCACCAAGGGG - Intronic
1089493507 11:118897536-118897558 CCCTGCTAGGGCTCACCAGGTGG + Exonic
1090553486 11:127848597-127848619 GTCTGCTTGAGCCCACCAGGAGG + Intergenic
1092260606 12:6951590-6951612 CCCTGCCTGGGCCGCCCAGGTGG + Exonic
1096052918 12:48627197-48627219 CCCGGCTGGGCACCAACAGGAGG - Intergenic
1096323976 12:50641701-50641723 CTGTGCTTGGGACCACCTGGCGG + Intronic
1096489300 12:52005091-52005113 CCCGCCTTGGCACCACCAAGTGG - Intergenic
1097244858 12:57602082-57602104 CCATCCTAGGGCCCACCAGGAGG - Exonic
1097359551 12:58643839-58643861 ACCTGCATGGGATCACCTGGGGG - Intronic
1099437257 12:82659471-82659493 CCCTGATTAAGCCCACCAGGCGG + Intergenic
1101968496 12:109296535-109296557 CCCTCCCTGGGGCCACCAGTTGG - Intronic
1103482496 12:121260147-121260169 CCCTGGTTGGGATCAGCAGGTGG - Intronic
1103555746 12:121765517-121765539 CCCTGCCTCAGACCACCAAGGGG - Intronic
1104676002 12:130712992-130713014 CCCTGCTTGTGTCCACCACTGGG - Intronic
1104678478 12:130731905-130731927 ACCTGCTCAGGGCCACCAGGTGG + Intergenic
1104959404 12:132481058-132481080 CCCTTCTTGGGAGCACCCTGTGG + Intergenic
1106419268 13:29572156-29572178 TCGTGCTTGGGACCCACAGGCGG - Intronic
1106772725 13:32978094-32978116 CGCTGCTTCAGACCTCCAGGTGG - Intergenic
1108038032 13:46312419-46312441 CCCTGCTTGGGGCTACAAGCAGG - Intergenic
1119749459 14:77067123-77067145 CCCTGCTCTGCACCCCCAGGAGG + Intergenic
1119861635 14:77940352-77940374 CCCTGCTGGGCACCAACAGGTGG - Intergenic
1121221469 14:92288564-92288586 CCCTACTGGGAAACACCAGGAGG + Intergenic
1122007110 14:98714737-98714759 CCCTCCTTGGGACCAGCGTGGGG - Intronic
1122113108 14:99515196-99515218 CCCTGCTGGGGGTCCCCAGGGGG - Exonic
1122323027 14:100866880-100866902 CCCTTCCTGGGACCAGGAGGCGG + Intergenic
1122543771 14:102511261-102511283 CCATGCATGGACCCACCAGGGGG + Intergenic
1123132483 14:105999744-105999766 GCATGCTCAGGACCACCAGGGGG - Intergenic
1129745249 15:78014661-78014683 AACTGCTTGAGCCCACCAGGAGG + Intronic
1129832393 15:78679399-78679421 CACTGCTTGAGGCCTCCAGGAGG - Intronic
1129884278 15:79027687-79027709 CGCTGCTGGGGCCCACCTGGTGG + Intronic
1130681815 15:86003572-86003594 CCCTGCTTGAAACCACCCAGTGG - Intergenic
1131283595 15:91040020-91040042 CTCTGCTTGAGGCCCCCAGGAGG + Intergenic
1132212616 15:100035641-100035663 GCTAGCTTGGGGCCACCAGGAGG + Intronic
1132678942 16:1131825-1131847 CCCTGCTGGGGCCCACGAGCAGG + Intergenic
1134014060 16:10876534-10876556 TCCTCCTTGATACCACCAGGAGG + Intergenic
1134881546 16:17748664-17748686 GCCTCCTGGGGACCACAAGGGGG + Intergenic
1135606088 16:23826062-23826084 CCCTGCTGAGGAACACCATGTGG + Intergenic
1139572832 16:67824094-67824116 CCCTGCTGTGGAGCACCAGAAGG - Intronic
1140960058 16:79903037-79903059 CCCAGCTAGTGACCACCAAGGGG - Intergenic
1141170965 16:81691457-81691479 CCCTCTTTGGGACCATTAGGGGG - Intronic
1141435473 16:83997364-83997386 CCCTGCTTGGGACCACCAGGAGG + Intronic
1142043835 16:87912707-87912729 ACTTGCTTGGGACGCCCAGGAGG + Intronic
1142245424 16:88968121-88968143 CCATGCTGGGGCCCACCTGGAGG + Intronic
1142484707 17:239098-239120 CCCTGCTGGGACCCACCAAGGGG + Intronic
1142814275 17:2412930-2412952 CCCTGAATGGGTCCACCAGATGG + Intronic
1143116865 17:4585914-4585936 CCCTGGATGGGACCTCCAGGGGG - Intronic
1143669013 17:8383589-8383611 CCCTGCTTCTGGCCGCCAGGAGG + Intergenic
1144052639 17:11510112-11510134 TCCAGCCTGGGACCACCAAGAGG - Intronic
1144631209 17:16873398-16873420 ACCTGCTGGGGACCATCAAGAGG + Intergenic
1146644654 17:34568957-34568979 CCCCTCTTTGGACCACCAGAAGG + Intergenic
1152251810 17:79216390-79216412 TCCTGGCTGGGACCACCTGGAGG + Intronic
1152717520 17:81907107-81907129 CCCAGCAAGCGACCACCAGGAGG + Intronic
1153443449 18:5146661-5146683 CCCTGCTCTAGATCACCAGGCGG - Intronic
1157110901 18:44819591-44819613 CCCTGCATGGGACCATGAGCAGG - Intronic
1160224425 18:77001223-77001245 CCCTGCATGGTCCCACCTGGAGG - Intronic
1161108510 19:2456054-2456076 CCCGGCTTGGGGTCTCCAGGGGG - Intronic
1164137071 19:22425784-22425806 ACCTGCCTGGGACGGCCAGGTGG + Intronic
1167096527 19:47377574-47377596 CTCTGCCTGGGGACACCAGGTGG - Intronic
1167605389 19:50479133-50479155 GGCTGCTGGGGACCAGCAGGGGG - Intronic
925913153 2:8586541-8586563 CCCTGCTTGGGAGCTCCTGGGGG - Intergenic
927965525 2:27265233-27265255 CCCTGCCGGGAGCCACCAGGCGG + Intronic
928078600 2:28288062-28288084 CCCTGCTTGGGAGCACAGGTTGG + Intronic
931141102 2:59459115-59459137 CCCGCCTTGAGCCCACCAGGTGG + Intergenic
932476352 2:72008764-72008786 CACTGCTCGGGAGCACCAGGAGG + Intergenic
939997434 2:148932849-148932871 CCCTGCTTGGGAGGTCAAGGAGG + Intronic
942094299 2:172523173-172523195 CACTGCTTGGGACCTACAGTGGG + Intergenic
942398345 2:175575818-175575840 TCCAGCTTGAGACCATCAGGCGG + Intergenic
945929855 2:215843889-215843911 CCCTGCCTGGGGCCAGGAGGAGG - Intergenic
945984523 2:216342851-216342873 CCCTGGGTGGGGCCACCAGCTGG + Intronic
947714631 2:232333418-232333440 CACTGCTGAGCACCACCAGGAGG - Intronic
947733760 2:232444539-232444561 CACTGCTGGGCACCACCAGGAGG - Intergenic
948014790 2:234679368-234679390 TCATGCTTGGGAACACCAGACGG + Intergenic
948328677 2:237148247-237148269 TGCTCCTTGGGACCACCAGCGGG - Intergenic
1168994092 20:2119744-2119766 GGCTTCTTGTGACCACCAGGAGG - Intronic
1170104215 20:12736302-12736324 CCCTGCTGGGGACAACCCTGAGG + Intergenic
1170848583 20:19982903-19982925 CCCTGCTGGGGAGCTCCAAGAGG - Intronic
1175911843 20:62408719-62408741 CCCTGCTGGCTATCACCAGGAGG + Intergenic
1175968650 20:62672907-62672929 CAGTGCTGGGGACCACCCGGGGG - Intronic
1176015836 20:62931630-62931652 ACCTGCTGGCGAGCACCAGGAGG + Intronic
1179710024 21:43208016-43208038 CCCTGCCTGGGAGGAACAGGGGG + Intergenic
1179710041 21:43208074-43208096 CTCTGCCTGGGAGGACCAGGGGG + Intergenic
1179786311 21:43732162-43732184 CCCTCCCAGGCACCACCAGGAGG - Intronic
1181630383 22:24148054-24148076 CCCATCTTGGGACCAAAAGGAGG + Intronic
1181940550 22:26472576-26472598 CCCTGCTTGCCACCCCCACGCGG - Intronic
1182580233 22:31304094-31304116 CCCAGACTGGGACCACAAGGAGG - Intergenic
1183206963 22:36426332-36426354 CCCTGTGTGGGAGCTCCAGGGGG - Intergenic
1183610618 22:38901595-38901617 CCCTGCCTGGTACCATCAGTGGG - Intergenic
1185061736 22:48610554-48610576 GGCAGCTCGGGACCACCAGGAGG + Intronic
1185271102 22:49929606-49929628 CCCTGCCCGGGCCCAGCAGGTGG + Intergenic
949888389 3:8714079-8714101 CCCTGCTGGGGGCCTCTAGGCGG + Intronic
950113473 3:10435292-10435314 CCTTATTTGGGACCACCTGGTGG - Intronic
950200015 3:11036095-11036117 CCCTGAATGGGAGCTCCAGGAGG - Intronic
951097646 3:18650471-18650493 CCCTGATTTGTACCACCATGTGG + Intergenic
951453157 3:22862321-22862343 ACCTCCTTGGTACCACCAGGAGG - Intergenic
954393418 3:50279389-50279411 CCCTGCTGGGGACATCAAGGAGG + Intronic
954889651 3:53913452-53913474 CCCTGCTTGGGAGGCCGAGGCGG - Intergenic
956467804 3:69536256-69536278 CTCTCCTGGGGACCATCAGGGGG + Intronic
956751534 3:72347732-72347754 CCCTGATTGTGACCCCCACGTGG + Intergenic
961322071 3:126083494-126083516 CCCGGCTGGGCACCCCCAGGAGG + Intronic
965120658 3:164551044-164551066 CTCTGCTTTTCACCACCAGGAGG + Intergenic
968325558 3:197811535-197811557 CACTGCGTGGGACCGCCTGGAGG + Intronic
968583247 4:1404498-1404520 CCCTGCTCGGCCTCACCAGGAGG + Intronic
968943644 4:3652415-3652437 CCCTGCTTGGGGCCACGGAGGGG - Intergenic
969302247 4:6303964-6303986 TCCTGCATGGCAACACCAGGTGG - Intergenic
971052268 4:22874859-22874881 CCCTGCCTGGGGCCACCAGATGG + Intergenic
974028879 4:56757983-56758005 CCCTGCTCCGGCCCTCCAGGAGG + Intergenic
974878401 4:67724239-67724261 CGCTGCTTGGGACCAGCCTGCGG + Intergenic
975725063 4:77283885-77283907 CCCTGCTTAGTACCACCTGAGGG + Intronic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
982209052 4:153020360-153020382 CCCTTCCTGGGGCCACCTGGAGG - Intergenic
988681448 5:33488245-33488267 CCCTGCTTGGGAAGTGCAGGAGG + Intergenic
990897841 5:60717911-60717933 CCCAACTTGGGAGCCCCAGGTGG + Intergenic
992587147 5:78252284-78252306 TCCTGCTTGAGAACAGCAGGGGG + Intronic
1004431733 6:15551192-15551214 CCCTGCTTGGGGCCCTCAGCAGG + Intronic
1004473300 6:15947954-15947976 CCCTCCTTGGGACCCCCAGTGGG - Intergenic
1006638228 6:35475142-35475164 CCCGGCTCGTGACCACCTGGGGG + Exonic
1007337394 6:41163335-41163357 CCCTGGCTGGCACCAGCAGGAGG - Intergenic
1016688893 6:146912916-146912938 CCCTTCTTGTGAACACCTGGGGG + Intergenic
1019262533 7:89557-89579 CCCAGCTGGAGACCAGCAGGTGG - Intergenic
1019412434 7:912144-912166 CCCTGCCTGGTACCACCAGGAGG + Intronic
1019527872 7:1488896-1488918 CCCTGCGTGGGATCAGCAGTGGG - Intronic
1024763402 7:52628285-52628307 CCCTTCTTGGGACCATCTGATGG + Intergenic
1024984525 7:55183634-55183656 CCCTGCTTCAGATAACCAGGAGG - Intronic
1026930110 7:74219261-74219283 CGCTCCCTGGGACCAGCAGGTGG + Intronic
1027267310 7:76501501-76501523 CCCTGCCTGGAACCGCCAGCAGG + Intronic
1027319121 7:77001366-77001388 CCCTGCCTGGAACCCCCAGCAGG + Intergenic
1033276268 7:139973896-139973918 CCCTGTTTGGTCCCAGCAGGGGG - Intronic
1035240242 7:157524362-157524384 CCCCTTTTGGGACCACCCGGTGG - Intergenic
1035250578 7:157594389-157594411 CCGGGCTTTGGATCACCAGGAGG + Intronic
1035251145 7:157597997-157598019 GCCTGCGTGAGACCACAAGGAGG - Intronic
1035281195 7:157779524-157779546 CCCTGCTGGGGACAACGTGGAGG - Intronic
1036983032 8:13492594-13492616 CCCTGCTTGGAATCTCCAGTGGG + Intronic
1037903321 8:22700987-22701009 CTCTCCTTGGGGCCCCCAGGGGG - Intergenic
1038856210 8:31335866-31335888 CCCTGGTTGGGACAAACATGGGG + Intergenic
1049178389 8:141207742-141207764 CCCTCCTTGGGTCCTCCAGGAGG - Intronic
1049312811 8:141942481-141942503 TCCTGCTGGGGACAACCAAGTGG + Intergenic
1050665086 9:7926828-7926850 TACTGCTTGGGGCCACCATGTGG + Intergenic
1053462873 9:38284309-38284331 CCCTGCCTGGGGCCTCCATGTGG - Intergenic
1053469985 9:38339514-38339536 CCTTGCCTGGGACCACTATGGGG - Intergenic
1057225967 9:93293281-93293303 CCCTGCTTGGCAGCTCCAAGTGG - Intronic
1059483985 9:114612830-114612852 CCCTGCTAGGGATCACCATCTGG - Intronic
1060123845 9:121023249-121023271 CCCTGTCTGTGTCCACCAGGAGG + Intronic
1060265850 9:122111093-122111115 ACCTGCTGGGGACCACAACGGGG - Intergenic
1060794292 9:126503951-126503973 CCCTGCTTGGATCCACCACCAGG + Exonic
1061016167 9:127981800-127981822 CCCAGCTCAAGACCACCAGGTGG + Intergenic
1061199915 9:129131841-129131863 CTCTGCTGTGGTCCACCAGGGGG + Intronic
1061660903 9:132129765-132129787 TCCTGCTGGGGACCATCACGTGG + Intergenic
1062327799 9:136020513-136020535 CTCTGCTGGGCTCCACCAGGCGG - Intronic
1187271098 X:17780435-17780457 CCCTCCTTAGGAGCAACAGGTGG - Intergenic
1194884784 X:99300229-99300251 CCTTGATTGGGAGCACCATGTGG - Intergenic
1199732636 X:150651624-150651646 GCCTGCTAGACACCACCAGGTGG - Intronic