ID: 1141438723

View in Genome Browser
Species Human (GRCh38)
Location 16:84015676-84015698
Sequence CTGCTAATAAAGACCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 2, 2: 85, 3: 158, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141438719_1141438723 24 Left 1141438719 16:84015629-84015651 CCTACGTCAAGAATGTCCATCAG 0: 1
1: 0
2: 1
3: 3
4: 79
Right 1141438723 16:84015676-84015698 CTGCTAATAAAGACCTACCAGGG 0: 1
1: 2
2: 85
3: 158
4: 193
1141438721_1141438723 8 Left 1141438721 16:84015645-84015667 CCATCAGGAGCTGTATTAGTCTG 0: 1
1: 1
2: 2
3: 23
4: 214
Right 1141438723 16:84015676-84015698 CTGCTAATAAAGACCTACCAGGG 0: 1
1: 2
2: 85
3: 158
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141438723 Original CRISPR CTGCTAATAAAGACCTACCA GGG Intronic
900771917 1:4552160-4552182 CTGCTGATAAAGACATACCTGGG + Intergenic
902699183 1:18159980-18160002 TTGCTAATAAAGACATACCCAGG - Intronic
902710526 1:18236417-18236439 CTGCTAATAAAGACAAACCTGGG - Intronic
903575001 1:24334206-24334228 CTGCTAATAAAGACATACCCAGG + Intronic
905584692 1:39106874-39106896 ATGCGAAAAAAGACCTACTAGGG + Intronic
908019859 1:59888398-59888420 CTGCTGATAAAGACATTCCTAGG + Intergenic
908553923 1:65237966-65237988 CTGTTAATAAAGACATACTTGGG + Intergenic
909593905 1:77382749-77382771 CTGCTAATAAAGAGTTAACATGG + Intronic
909752484 1:79179805-79179827 CTGCTGATAGAGACATACCCAGG + Intergenic
909782661 1:79566151-79566173 CTGCTAATAAAGACATACCCAGG + Intergenic
911407997 1:97465739-97465761 CTGCTAATAAAGACATACCCGGG - Intronic
911736587 1:101343182-101343204 CTGCTGATAAAGACATACCCGGG - Intergenic
912147427 1:106810195-106810217 CTGCTGATAAAGACATACTTGGG - Intergenic
912154893 1:106905343-106905365 CAGCTAAAAAATACCTGCCATGG + Intergenic
912157919 1:106945285-106945307 CTGCTAATAAAGACATACCCAGG + Intergenic
912717955 1:111995149-111995171 CTGCTCATCAAGACCTCCCTTGG + Intergenic
913151793 1:116051875-116051897 CCGCTGATAAAGACATACCCAGG - Intronic
915047358 1:153029559-153029581 CTGCTGACAAAGACATAACAGGG + Intergenic
915219050 1:154359383-154359405 TTGCTAATAAAGACATACCCAGG + Intergenic
915267787 1:154731386-154731408 CTGCTAATAGGGACCTGCCCTGG + Intronic
917572138 1:176278525-176278547 CTGCTGATAAAGATATACCCGGG - Intergenic
918208356 1:182329070-182329092 CCGCTAATAAAGACATACCCGGG + Intergenic
918541225 1:185635023-185635045 CTGCCAATAAAGACATACCCGGG - Intergenic
918721022 1:187851509-187851531 CTGATAATAAAGACCAGTCATGG - Intergenic
920903700 1:210138106-210138128 CTGCCAATAAAGACATACTGAGG + Intronic
921253448 1:213318561-213318583 CTGCTAATAAACACATACCCAGG + Intergenic
922368146 1:224885286-224885308 CTGCTAATAAAGACATACCCGGG + Intergenic
923965674 1:239135883-239135905 CTGCTGATAAAGACATACCAGGG + Intergenic
924178005 1:241412328-241412350 CTGCTAATAAAGACATACCCAGG - Intergenic
1063724937 10:8626589-8626611 CTTCCAATAAACAACTACCAAGG - Intergenic
1063883342 10:10553038-10553060 CTGCTAATAAAGACATACCAAGG + Intergenic
1064819203 10:19306652-19306674 CTGCTGATAAAGACATACCCAGG + Intronic
1064919805 10:20504111-20504133 CTGCTAATAAAGACATACCTGGG - Intergenic
1065635419 10:27728403-27728425 CTGCTCAAAAAGATCTGCCAAGG + Intronic
1066640348 10:37549080-37549102 CTGCTATCAAAGATCTTCCAGGG - Intergenic
1067033209 10:42894190-42894212 CTGCTGATAAAGACATACCTGGG - Intergenic
1068676658 10:59776615-59776637 ATGCTGATAAAGACATACCCTGG + Intergenic
1069178321 10:65323260-65323282 CTGCTAATAAAGACATACCCAGG - Intergenic
1070714772 10:78711409-78711431 CTGCTAATAAAGACATGCCCAGG - Intergenic
1071917907 10:90316650-90316672 CTAGTAATAAATACCTATCAGGG + Intergenic
1073675251 10:105639202-105639224 CTGCTGATAAAGACATACCCAGG - Intergenic
1073810841 10:107150936-107150958 CTGCTAATAAAGATATACCCGGG - Intronic
1073828564 10:107355527-107355549 CTGCTGATAAAGACATACCTGGG + Intergenic
1074178111 10:111031849-111031871 CTGCTGATAAAGACATACTAGGG + Intergenic
1074302996 10:112249748-112249770 TTGCTAATAAAGACATACCCGGG - Intergenic
1075057776 10:119232796-119232818 CTGCTGATAAAGACATACCCAGG - Intronic
1075152849 10:119950124-119950146 CTGCTAATAATGACATACCCAGG - Intergenic
1075281775 10:121144898-121144920 CTGCTAATAAAGATATGCCCAGG + Intergenic
1076090183 10:127678953-127678975 CTGCTGATGAAGACATACCCAGG + Intergenic
1078912278 11:15744207-15744229 ATGCTAATAAAGACACACCTGGG + Intergenic
1079511392 11:21215362-21215384 CTGCTAATAAAGAACTAGCTGGG - Intronic
1079546720 11:21642262-21642284 CTGCTAATAAAGACATATCTGGG - Intergenic
1079750650 11:24192074-24192096 CTGCTAATAAACACATACCTGGG + Intergenic
1080049221 11:27841920-27841942 CTGAGAATAAAAACCTACCTGGG - Intergenic
1080417156 11:32079378-32079400 CTGCTGATAAAGACATACCTGGG - Intronic
1080557975 11:33434425-33434447 CTGCTAATAAAGACACACCTTGG - Intergenic
1081405704 11:42694955-42694977 CTGCTGATAAAGACATACCCAGG - Intergenic
1083519197 11:63292067-63292089 CTGCTAATAAAGACATACCTGGG + Intronic
1084435363 11:69136324-69136346 CTGCTAATAAAGACATACCTGGG - Intergenic
1085905063 11:80750381-80750403 CTGCTAATAGAGACATACCTGGG + Intergenic
1086503549 11:87478674-87478696 CTGCTAATAAAGACATACCAGGG - Intergenic
1086613479 11:88785993-88786015 CTGCTAGTTCAGAACTACCAAGG + Intronic
1087897255 11:103600344-103600366 CTTCAAATACAGACCTACAAAGG - Intergenic
1087908733 11:103728156-103728178 CTGCTAATAATGACATACCTGGG + Intergenic
1087995514 11:104802660-104802682 CTACTACTTCAGACCTACCAGGG + Intergenic
1088162956 11:106895693-106895715 CTGCTAAGAAAGACATACCTGGG - Intronic
1088762912 11:112949226-112949248 CTGCTAATAAGGACATACCTGGG + Intergenic
1089985088 11:122805052-122805074 CTGCTGACAAAGACATACCTGGG + Intronic
1090737024 11:129618913-129618935 CTGGAAATAGAGAGCTACCAGGG + Intergenic
1091812739 12:3413401-3413423 CTGCTAATAAAGACATACCCAGG - Intronic
1092651768 12:10642387-10642409 CTGATGATAACTACCTACCAGGG + Intronic
1093353264 12:18129275-18129297 CTGCTGATTAAGACATACCCAGG - Intronic
1094416743 12:30224262-30224284 TTGCTGATAAAGGCATACCAGGG - Intergenic
1095847361 12:46760012-46760034 CTACTAATAAAGACATACCAGGG - Intergenic
1097671306 12:62542260-62542282 GTGCTAATAAAAATCTAACAGGG - Intronic
1098327173 12:69315366-69315388 CTGCTAATAAAGACATACTGAGG + Intergenic
1098731725 12:74043991-74044013 CTGCTGATAAAGACATACCAGGG + Intergenic
1098840780 12:75475733-75475755 CTGCTGATAAAGACATACCCAGG + Intergenic
1098944527 12:76574740-76574762 CTGCTAATAAAGAAATACCTGGG + Intergenic
1099218655 12:79884902-79884924 CTGCTAACAAAGAGTTAACAAGG + Intronic
1099594006 12:84634532-84634554 CTGCTGATAAAGACATACCCAGG + Intergenic
1099811376 12:87586663-87586685 CTTCTGATAAAGACATGCCATGG - Intergenic
1099819321 12:87690183-87690205 CTGCTGATAACGACATACCTGGG + Intergenic
1100147606 12:91697439-91697461 CTGTTAATGAAGACATACCCAGG + Intergenic
1100147858 12:91699366-91699388 CTGCTAATAAAGACATACACAGG + Intergenic
1100578930 12:95920413-95920435 CTGCTAATAAAGACATACCCAGG - Intronic
1100657811 12:96666415-96666437 CTGCTCATAAAGACATACCTGGG + Intronic
1100714848 12:97294814-97294836 CTGCTAATTAAGACATACCTGGG - Intergenic
1101194476 12:102368812-102368834 CTGTTAATAAAGACATACCCAGG + Intergenic
1101340409 12:103837959-103837981 CTGCTAATAAAGACACACCTGGG + Intronic
1103222442 12:119257068-119257090 CTGCTAATAAAGACATACCTGGG - Intergenic
1104038089 12:125112377-125112399 CTGCTGATAAAGACATACTGAGG + Intronic
1104170952 12:126279791-126279813 CTGCTAATGAAGACGTACCCGGG - Intergenic
1104656942 12:130580538-130580560 CTGCTAATAAAGACATACCTGGG - Intronic
1105236087 13:18554890-18554912 CTGCTAATAAAGACATACTTGGG - Intergenic
1107364887 13:39660135-39660157 CAGTCAATAAAAACCTACCAAGG - Intronic
1108050205 13:46427326-46427348 CTGCTGATAAAGACATATCTGGG - Intronic
1109285895 13:60408271-60408293 CTGCTGATAAAGACATACCTGGG - Intronic
1109398483 13:61792604-61792626 CTGCTCATAAAGTCCTTCTATGG + Intergenic
1109542726 13:63800646-63800668 CTGCTGATAAAGACATATCTGGG - Intergenic
1109697230 13:65977003-65977025 CTGCTGATAAAAACATACCTGGG - Intergenic
1110552028 13:76821211-76821233 CTGCTAATAAAGACATACCCGGG + Intergenic
1111089637 13:83426946-83426968 CTGCTAATAAAGACACACCTGGG + Intergenic
1111105827 13:83643622-83643644 CTGCTGATAAAGACATACCCAGG + Intergenic
1111260821 13:85737744-85737766 CTGCTAATACATACATACCCTGG - Intergenic
1111378889 13:87419809-87419831 CTGCTAATAAAAACATAACCAGG + Intergenic
1111518605 13:89367963-89367985 CTCCTGATAAAGACGTACCCAGG + Intergenic
1111614164 13:90642943-90642965 CTGCAAATAAAGACATACCCAGG + Intergenic
1112190430 13:97172036-97172058 CTGCTGATAAAGACATATCCAGG - Intergenic
1112973313 13:105287199-105287221 CTACTAATAAAGACATACCTGGG + Intergenic
1113096946 13:106676159-106676181 GTGCTGATAAAGACATACCCAGG + Intergenic
1113341616 13:109431734-109431756 CTGCTAATAAAGACATATCTAGG + Intergenic
1114229631 14:20768739-20768761 CTGATGATAAAGACCTACAGAGG - Intronic
1114320818 14:21545858-21545880 CTGCTAATAACAACATACCTGGG + Intergenic
1115113832 14:29855969-29855991 CTGCTAATAAAGATGTACGCAGG - Intronic
1115359052 14:32481394-32481416 CTGCTAATAAAGACATACCCGGG + Intronic
1117256661 14:53985099-53985121 CTGCTGATAAAGACATACCTGGG - Intergenic
1118432008 14:65728267-65728289 CTGCTAATAAAGACATACTCAGG + Intronic
1120518561 14:85499453-85499475 CTGCTAATAAAGACATGCCTGGG + Intergenic
1120609559 14:86623432-86623454 CTGCTGAGAAAGACATACCTGGG - Intergenic
1120670125 14:87353713-87353735 CTGCTAGTAAAGACATACTTGGG + Intergenic
1120801437 14:88693248-88693270 CTGTTCATAAAGACATACCCAGG + Intronic
1121267703 14:92615139-92615161 CTGCTGATAAAGACATACCCGGG - Intronic
1124062551 15:26307516-26307538 CTGCTAATAAAGACATACCCTGG + Intergenic
1125174084 15:36800286-36800308 CTGCAAATACAGACCTGGCAAGG + Intronic
1125745156 15:41992744-41992766 CTGCTGATAGAGACCTGCCTGGG - Exonic
1126413303 15:48394066-48394088 CTCCTAATAAAGGCCCATCATGG - Intergenic
1127244728 15:57160157-57160179 TTGCTAATGAAGACATACCTGGG + Intronic
1128033065 15:64499040-64499062 CTCCTAGTTAAGACTTACCATGG + Intronic
1128749016 15:70135195-70135217 CTGCTGATAAAGACATACCGAGG + Intergenic
1131138208 15:89955498-89955520 CTGCCGATAAAGACATACCTGGG + Intergenic
1131462721 15:92630022-92630044 CTGCTAATAAAGACATACCTGGG - Intronic
1131800248 15:96060897-96060919 CTGCTGATAAAGATATACCCGGG - Intergenic
1132029697 15:98429764-98429786 CTGCTGATAAAGACATACCTGGG - Intergenic
1132208977 15:100006550-100006572 TTGAAAATAACGACCTACCAGGG - Intronic
1133507897 16:6430174-6430196 CCGCTAATAAAGACATACCTGGG - Intronic
1135810398 16:25581529-25581551 CTGCTAATAAAGACATACCTGGG - Intergenic
1137018659 16:35400497-35400519 CTGCTGAAAAAGACATACCTAGG - Intergenic
1139329942 16:66179914-66179936 CTGCAAATATAGACCTTGCAGGG + Intergenic
1140632137 16:76866073-76866095 CTGCTGATAAAGACATGCTAGGG + Intergenic
1141262425 16:82466201-82466223 CTGCTAATAAAGACATACCCAGG + Intergenic
1141322516 16:83025299-83025321 CTACTAATAAAGACATACCTGGG + Intronic
1141342855 16:83219045-83219067 CTGCTAATGAAGACATACCCGGG - Intronic
1141438723 16:84015676-84015698 CTGCTAATAAAGACCTACCAGGG + Intronic
1143364580 17:6397847-6397869 CTGCTGATAAAGACATACCTGGG + Intronic
1143372756 17:6450468-6450490 CTGCTAACAAGCACCTAACAAGG + Exonic
1145230188 17:21168325-21168347 CTGCTAACAAAGAATGACCATGG - Intronic
1146083732 17:29807777-29807799 ATGCTAATAAATACCTTCCCTGG - Intronic
1149025807 17:52026511-52026533 CTGCTAACAAAGACATACCCAGG + Intronic
1149109316 17:53008349-53008371 CTGCTAATAAAGACATACCCAGG + Intergenic
1150830724 17:68517352-68517374 CTGCTAATAAAGACATACCGAGG + Intronic
1151049084 17:70956303-70956325 CTGCTAATATGGACATACCCAGG - Intergenic
1151397964 17:73837158-73837180 CTGCTGATAAAGACACACCTGGG - Intergenic
1153085020 18:1275219-1275241 CTGCTAATAAAGACATACCCCGG - Intergenic
1153539194 18:6135911-6135933 CTGCTGATAAAGACATACAGGGG + Intronic
1154048857 18:10934013-10934035 CTGCAAATAAAGACTTACCCTGG - Intronic
1154328709 18:13411746-13411768 CTGCTAATAAAGACATAACAGGG - Intronic
1154513454 18:15135108-15135130 CTGCTAATAAAGACATACTTGGG + Intergenic
1155685044 18:28538290-28538312 CTGCTAATAAAGACATACCTGGG + Intergenic
1155807357 18:30188908-30188930 CTGCTGATAAAGACATACCCGGG + Intergenic
1158267479 18:55676449-55676471 CTGTTGATAAAGACATACCCAGG + Intergenic
1158508833 18:58071662-58071684 CCGCTAATAAAGACATACCTGGG + Intronic
1158780301 18:60641244-60641266 GTGCTAATAAAAACATACCCAGG + Intergenic
1159349909 18:67259013-67259035 CTGCTGATAAAGACACACCCAGG - Intergenic
1159507907 18:69359915-69359937 CTGCTGATAAAGACATAGAATGG - Intergenic
1159718975 18:71861465-71861487 CTGCTGATAAAGACATACCTGGG + Intergenic
1159746441 18:72242364-72242386 CTGCTAATAAAGACATACCCAGG + Intergenic
1159920234 18:74221206-74221228 CTGCTGATAAAGACATACCCGGG - Intergenic
1160262061 18:77303344-77303366 CTGCTAATAAACACATACCGGGG - Intergenic
1164209890 19:23089706-23089728 CTGCTGATAAAGACATAACCAGG - Intronic
1164794818 19:31017349-31017371 CTGCTAATACAGACATACCTGGG + Intergenic
1164933573 19:32194298-32194320 CTACTAATAAAGATATACCTAGG + Intergenic
1165558050 19:36653462-36653484 CTGCTGATAAAGACATACCCAGG + Intronic
1168669855 19:58232627-58232649 ATGCTAATAAAGACATATCCGGG + Intronic
925803743 2:7628187-7628209 CTGCTGATAAAGACATACCCGGG + Intergenic
926502571 2:13674102-13674124 CTGCTGATAAAGATATACCCAGG + Intergenic
926774167 2:16405648-16405670 CTGCTAATAACAAAATACCACGG + Intergenic
926882755 2:17566078-17566100 CTGCTAATAAAAACATACTAGGG - Intronic
926952010 2:18253290-18253312 CCGCTAATAAAGACGTACATGGG - Intronic
927340804 2:21981687-21981709 CTGCTGATAAAGACATGCCTGGG + Intergenic
928890806 2:36200723-36200745 CTGCTGATAAAGACACACCTGGG - Intergenic
929621131 2:43355075-43355097 CTGCTAATAAAGACATACCCAGG - Intronic
929811452 2:45192527-45192549 CTGCTGATAAAGACTACCCAAGG + Intergenic
929855585 2:45636108-45636130 CTGCTGATAAAGACATACCCGGG - Intergenic
929965376 2:46530652-46530674 CTGCGAATAAAGACATAACCAGG + Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930263281 2:49171291-49171313 CTGCTGATAAAGACCTACCCAGG - Intergenic
930436971 2:51356581-51356603 CTGCTAATAAAGACATACCCAGG - Intergenic
930438380 2:51376209-51376231 CTGCTAGTAAAGACATACCTGGG - Intergenic
930438619 2:51378215-51378237 CTGCTAATAAAAACATACATGGG - Intergenic
931824753 2:65988925-65988947 CTGCTAATAAAGACATACCCAGG + Intergenic
932318122 2:70799944-70799966 CTGCTGATAAAGACGCACCCAGG + Intergenic
932484299 2:72073332-72073354 CTACTAATAAGGATCTAACAAGG + Intergenic
932562342 2:72884292-72884314 CTGCTGATAAAGACATACCTGGG + Intergenic
932849412 2:75170419-75170441 CTGCTAATAAAGACATACTCAGG - Intronic
934940553 2:98498460-98498482 CTGCTGATAAAGACATACCCAGG - Intronic
937554939 2:123142275-123142297 CTGCTCATAAAGACATACCCAGG - Intergenic
937620494 2:123979795-123979817 CTGCTAATAAAGACGTACCCAGG - Intergenic
938513699 2:131979719-131979741 CTGCTAATAAAGACATACTTGGG + Intergenic
938789627 2:134665185-134665207 CTGCTAATAAAGACATACCCAGG + Intronic
938944234 2:136196741-136196763 CTGCTAATAAAGACATACCCAGG + Intergenic
939508193 2:143074914-143074936 CTGTTGATAAAGACATACCCAGG - Intergenic
940306408 2:152232022-152232044 CTGCTAATAAAGACATACCTGGG - Intergenic
940444617 2:153763643-153763665 CTGCTAATAAAGACATATGAGGG - Intergenic
940881387 2:158950353-158950375 CTGCTAAAACAGACCTAATAGGG + Intergenic
941450846 2:165658585-165658607 CTGCTGATAAAGACACACCCGGG + Intronic
942839459 2:180341477-180341499 GTGCAAATAAAGAGCTCCCAAGG - Intergenic
942991638 2:182209110-182209132 CTGCTGATAAAGACATACCCAGG + Intronic
943017442 2:182529917-182529939 CTGCTGATAAAGACATACCGAGG - Intergenic
943183527 2:184575661-184575683 CTGCTAATAAAGACATACCCAGG + Intergenic
943193819 2:184718023-184718045 CTGCTGATAAAGATATACCTGGG + Intronic
943386850 2:187211643-187211665 CTGGTGATAAAGACATACCCAGG - Intergenic
943841692 2:192591347-192591369 CTGCTAATGAAGACATATCTGGG - Intergenic
943880783 2:193141340-193141362 CAGCTAATAGAGACATACCCGGG + Intergenic
943941816 2:194008392-194008414 CTGCTGATAAAGACATACCCAGG + Intergenic
944475143 2:200095832-200095854 CTGCTAATAAAGACATACCCAGG - Intergenic
945097990 2:206237827-206237849 CTGGTCATAAAGATCTAACAGGG + Intergenic
945671135 2:212804110-212804132 CTGCTGATAAAGACATACCCAGG + Intergenic
947349269 2:229225629-229225651 CTGCTAATAAAGACATACATGGG + Intronic
1173045458 20:39505135-39505157 CTGCTAATAAAGACATACCTGGG - Intergenic
1173264039 20:41461652-41461674 CTGCTGATAAAGACATACCGGGG - Intronic
1173898670 20:46570917-46570939 CTGCTAATAAAAACATACCCGGG + Intronic
1174540728 20:51287251-51287273 CTGCTAATGAAGACATACCTGGG + Intergenic
1174635632 20:51997247-51997269 CTGCTAATAAAATCATACCTGGG + Intergenic
1175290509 20:57872061-57872083 CTGCTAATAAAGATATACCCAGG + Intergenic
1175527719 20:59647071-59647093 CTGCTAATACAGACATATCTAGG + Intronic
1176659365 21:9619801-9619823 CTGCTAATAAAGACATACCTGGG + Intergenic
1176780085 21:13183177-13183199 CTGCTAATAAAGACATACTTGGG - Intergenic
1177013739 21:15758624-15758646 CTGCTAATAAAGACATACCTGGG + Intronic
1177059585 21:16354024-16354046 CTGCTGATAAAGACCTGAGATGG - Intergenic
1177145968 21:17407204-17407226 CTGCTGATAAAGACATATCCAGG - Intergenic
1177315574 21:19456953-19456975 CTGCTGATAAAGACATACACAGG + Intergenic
1177392897 21:20499302-20499324 CTGCTGATAAACACATACCTGGG + Intergenic
1177977739 21:27872194-27872216 CTGCTAATAAAGACATACTTGGG - Intergenic
1178174137 21:30076933-30076955 CTGCTAATAAAGACATACCCAGG - Intergenic
1179071322 21:38073745-38073767 CTACTAATGCAGACTTACCAAGG - Intronic
1179227369 21:39466488-39466510 CTGCTAATAAAGACGTACCCAGG + Intronic
1179398205 21:41060411-41060433 CTGCTAATAAAGACATGCCCAGG + Intergenic
1180305584 22:11120544-11120566 CTGCTGTTAAAGACATACCCAGG - Intergenic
1180544103 22:16482723-16482745 CTGCTGTTAAAGACATACCCAGG - Intergenic
1182650475 22:31847400-31847422 CTGCTAATAAAGACATACCTGGG + Intronic
1182802264 22:33041215-33041237 CTGCTAATAAAGGAGTACCCAGG - Intronic
1183073750 22:35413671-35413693 TTGCTAGGCAAGACCTACCATGG + Intronic
1184655033 22:45936783-45936805 CTGCTCACAAAGATCTGCCAGGG - Intronic
1185124415 22:48999338-48999360 CTGCTGATAAAGACATACCTGGG + Intergenic
949370730 3:3332275-3332297 CTGCTAATAAAGACATACCTGGG + Intergenic
949796724 3:7859752-7859774 CTGCTGATAAAGACATACCCTGG + Intergenic
952239136 3:31511782-31511804 CTGCTAATAAAGACATACCCAGG - Intergenic
954174978 3:48837259-48837281 CTGCTAATACACTCCAACCAGGG + Intronic
956363388 3:68472409-68472431 CTGTTAATAAAGACATACACAGG - Intronic
956368568 3:68533164-68533186 CTGCTGATAAAGACATACATAGG + Intronic
956825147 3:72991208-72991230 CTGCTCTTAAACACCCACCATGG + Intronic
958152164 3:89704573-89704595 CTGCTGATAAAGACATACCCTGG + Intergenic
958507643 3:95000817-95000839 CTGCTAAGCAAGTCTTACCATGG + Intergenic
958819740 3:98959442-98959464 CTGCTAATAAAGATCTTACGGGG - Intergenic
959113653 3:102151148-102151170 CTGCTAATAAAGACATACCCAGG + Intronic
959268053 3:104168623-104168645 CTGCTGATAAAGACACACCCAGG + Intergenic
959438913 3:106352377-106352399 CTGCTAATAAAGACATACCCAGG - Intergenic
960540869 3:118861065-118861087 CTGCTGATGAAGACATACCCAGG - Intergenic
961099614 3:124187380-124187402 CAGCCAATAAAGACATACCCAGG - Intronic
962366766 3:134791962-134791984 CTGCTAATACAGATATACCTGGG + Intronic
963954695 3:151240884-151240906 CAGCTAATCAAGACCAAGCATGG - Intronic
964088696 3:152847952-152847974 CTGCTGATAAAGACATACCTGGG - Intergenic
965465880 3:169030263-169030285 CTGCTAATAAAGTCATACCCGGG + Intergenic
965955998 3:174369845-174369867 CTGCTAATATAGACATACCCAGG - Intergenic
966138839 3:176731776-176731798 CTGCTAATAAAGACATACCTGGG - Intergenic
966486256 3:180474529-180474551 CTGCTAATAAAGACATACCTAGG + Intergenic
969596944 4:8154794-8154816 CTGCCAATAAAGACATACCCAGG + Intronic
970046446 4:11859753-11859775 CTGCTAATGAAGATACACCAGGG - Intergenic
970054796 4:11958711-11958733 CTCCCAATAAAGACAAACCAAGG - Intergenic
970217885 4:13778687-13778709 CTGCTGATAAAGTCATACCCAGG + Intergenic
970340701 4:15103629-15103651 CTGCTAATAAAGACATACCTGGG - Intergenic
970552689 4:17198977-17198999 CTGTTAATAAAGACATACCTGGG + Intergenic
970776634 4:19682491-19682513 CTGCTAATTCAAACCTACTAAGG - Intergenic
970802206 4:19986246-19986268 CGGCTGATAAAGACATACCCAGG - Intergenic
971072274 4:23108234-23108256 CTGCTGATAAAGACATACCCAGG - Intergenic
971570572 4:28205748-28205770 CTGCTGTTAAAGACATACCAGGG + Intergenic
971784316 4:31081071-31081093 CTGCTAATAAAGACACACCCAGG - Intronic
971814968 4:31475993-31476015 CTGCTGATAATGACATACCTGGG + Intergenic
972063332 4:34909253-34909275 CTGCTGATAAAGACACACCTGGG - Intergenic
972485439 4:39535588-39535610 CTGCTGATAAAGACATACCTGGG - Intergenic
973107912 4:46362451-46362473 CTGCTGATAAAGACATACCTGGG - Intronic
974071317 4:57126803-57126825 CTGCTAATAAAGACATATCTGGG - Intergenic
974352787 4:60772193-60772215 CTGCTGACAAAGACATACCCAGG + Intergenic
974772326 4:66433004-66433026 CTGCTGATAAAGACATACCCAGG + Intergenic
975046121 4:69806835-69806857 CTGCTCATAAAGACATATCCAGG - Intergenic
975257451 4:72254808-72254830 CTGCTAATAAAGACATCCCTAGG - Intergenic
976049812 4:80998268-80998290 CTGCTAATAAAGACATACTCAGG - Intergenic
977996191 4:103499583-103499605 CTGCTTTTAAACACCTATCATGG + Intergenic
978043491 4:104098542-104098564 AAGCTAATAAAGACATACCTGGG - Intergenic
978083244 4:104620356-104620378 CTGCTGATAAAGACATACCAGGG + Intergenic
978226065 4:106337033-106337055 TTACTAATAAATACCTACCTGGG - Exonic
979392030 4:120139042-120139064 CTGCTGATAAAGACATACCGGGG + Intergenic
979922843 4:126523702-126523724 CTGCTGATAAAGACATACCCAGG + Intergenic
980484542 4:133438807-133438829 CGGCTAATTAAGACCTACAAAGG - Intergenic
983430133 4:167639479-167639501 CTGCTGATAAAGACATACCCAGG + Intergenic
983711513 4:170722669-170722691 CTGCTAATAAAGACATACCCAGG + Intergenic
983790020 4:171784367-171784389 CTACTAATAAAGACATATCTGGG + Intergenic
983901675 4:173142245-173142267 CTGCTAGTAAAGACATACGTGGG - Intergenic
984416153 4:179460163-179460185 CTGCTGATAAAGACATACCTGGG - Intergenic
984490540 4:180429977-180429999 CTAATAATAAATACCTAACAGGG + Intergenic
985416138 4:189737396-189737418 CTGCTAATAAAGACATACCTGGG - Intergenic
986146583 5:5083466-5083488 CTGCTAATAAAGACATACCCTGG - Intergenic
986808690 5:11333028-11333050 CTGCTGATAAAGGCATACCCAGG - Intronic
987247164 5:16060542-16060564 CTGCTGATAAAGACATATCTGGG + Intergenic
987455725 5:18143955-18143977 CTGATGATAAAGACATACCCGGG + Intergenic
987602197 5:20085565-20085587 CTTCTAATAAAGATATACCTGGG + Intronic
988385995 5:30566040-30566062 CTACTAATAAAGACATACCCAGG + Intergenic
988669030 5:33361191-33361213 CTGTTGATAAAGACATACCCAGG + Intergenic
989345932 5:40429427-40429449 CTGCTAGAAAACACCTACCCAGG + Intergenic
990075546 5:51842689-51842711 CTGCTGATAAAGACCTACCCAGG + Intergenic
990448040 5:55911064-55911086 CTGCTGATAAAGACATACCCGGG + Intronic
990696953 5:58429097-58429119 CTGTAAATTAAGACCTAGCATGG + Intergenic
992767087 5:80011285-80011307 CTGCTGATAAAGACATACATGGG - Intronic
993339583 5:86706998-86707020 CTGCTAATAAAGACATACCCAGG + Intergenic
993946069 5:94117746-94117768 CTGCTGATAAAGACATACCAAGG - Intergenic
994325807 5:98443332-98443354 CTGCTGATAAAGGCATACCTGGG + Intergenic
994947635 5:106416245-106416267 CTGCTGCTGAAGACATACCAGGG + Intergenic
995630624 5:114128189-114128211 CTGCTAATAAAGACATACTCAGG + Intergenic
996491327 5:124101080-124101102 CTGCCAATAATGACTTACAATGG - Intergenic
996967404 5:129322093-129322115 CTGCTGATAAAGATGTACCCAGG + Intergenic
997513898 5:134471930-134471952 CTGCTGATAAAGACATACCCAGG + Intergenic
999045906 5:148469058-148469080 CTGCTAATAAAGACATACCCAGG - Intronic
1000522979 5:162320019-162320041 CTGCTGATAAAGACATAACCAGG - Intergenic
1000578756 5:163009727-163009749 CTGCTAATAAAGATATACCCAGG + Intergenic
1000648274 5:163784724-163784746 CTTCTGATAAAGACTTACCTGGG + Intergenic
1003929550 6:10910664-10910686 CTGCAAATGGAGACCTACTATGG - Intronic
1004158327 6:13190742-13190764 CTGATAATACACACCTACCCAGG + Intronic
1004993906 6:21169691-21169713 CTGCTAATAAAGACATACCCAGG + Intronic
1005520093 6:26593382-26593404 TTGCTAATAAGTACCTATCATGG - Intergenic
1007980352 6:46149076-46149098 CTGCTAATAAAGACATACCTGGG + Intergenic
1008283776 6:49625758-49625780 GTTCTAATAAAGACATACCCAGG + Intronic
1008658869 6:53644764-53644786 CTGCTAATAAAGACATAACTGGG - Intergenic
1008755948 6:54795925-54795947 CTGCTAATAAAGACATACCTGGG + Intergenic
1010663385 6:78597820-78597842 CTGCTGATAAAGGCATACCCAGG + Intergenic
1011347593 6:86389008-86389030 CTGCTAATGAAGACATACCCGGG - Intergenic
1011912037 6:92452457-92452479 TTGCTAATAAAGACATAACCAGG - Intergenic
1012074867 6:94670837-94670859 CTGCTAATAAAGACATACCCAGG - Intergenic
1012691640 6:102320233-102320255 CTGCTAAAAAAGACATAACTGGG - Intergenic
1014234097 6:118935969-118935991 GTGCTAATAAAGACATACCTGGG + Intergenic
1014476061 6:121873214-121873236 CTGCTAATAAAGACATACCTAGG + Intergenic
1014781403 6:125569049-125569071 CTGCTGATAAAGACATACCCAGG - Intergenic
1014857066 6:126415857-126415879 CTGCCAATAAAGACATAACTGGG - Intergenic
1015053950 6:128876325-128876347 CTTCCAATAAAGACATACCCAGG - Intergenic
1016139624 6:140593182-140593204 CTGCTGATAAAGACATACCAGGG - Intergenic
1016288005 6:142495067-142495089 CTGCTAATAAAGACATACCCAGG + Intergenic
1016685527 6:146878126-146878148 TTACTAATAAAGGCCTACTACGG - Intergenic
1017346645 6:153390951-153390973 CTGCTGAAAAAGACATACCTGGG - Intergenic
1018237738 6:161742431-161742453 CTGCTAATAAAGACATACCCAGG - Intronic
1018909322 6:168092908-168092930 CTGCTCATAAAGACATGCCCGGG + Intergenic
1019050470 6:169179258-169179280 CTGCTGATAAAGACATACCTGGG + Intergenic
1019534402 7:1521147-1521169 CTGCTGAAAAAGACATACCCTGG + Intergenic
1021482456 7:21132755-21132777 CTGCTAATAAAGACATATCCAGG + Intergenic
1021598431 7:22341086-22341108 CTGCTGATAAAGACATACCCAGG + Intronic
1021598715 7:22343030-22343052 CTGCTGATAAAGACATACCCTGG + Intronic
1022081027 7:27021259-27021281 CTGCTGATAAAGACATACCTGGG - Intergenic
1022459156 7:30587615-30587637 CTGCTAATAAAGACATACCCAGG + Intergenic
1023384059 7:39637322-39637344 CTGATAATAAAGATCAAACAAGG - Intronic
1023652175 7:42382933-42382955 CTGCTGATAAAGACATACCCAGG - Intergenic
1026051465 7:66950565-66950587 CTGCTGATAAAGACATACCCGGG - Intronic
1026278575 7:68902018-68902040 CTGCTGATACAGACATACCTGGG - Intergenic
1027716591 7:81679280-81679302 CTGCTAATAAAAACTAACCTTGG + Intergenic
1028957671 7:96712289-96712311 CTGCTAATAAAGACATACCTGGG - Intergenic
1030904123 7:115162033-115162055 CTGCTGATAAAGACATAGCTGGG + Intergenic
1031012516 7:116538716-116538738 CTGCTGATAAAGACATATCCGGG + Intronic
1031225167 7:119027217-119027239 ATGCTAATAAATACTTACAAAGG - Intergenic
1031298690 7:120038171-120038193 CTGCTGATAAAGACATACCCAGG + Intergenic
1031546345 7:123054655-123054677 CTGCTAATAAAGACATACCTGGG - Intergenic
1031778350 7:125930769-125930791 CTGCTGATAAAGACATATCCAGG + Intergenic
1032076532 7:128838703-128838725 CTGCACATACAGACCTGCCATGG + Exonic
1032210782 7:129912047-129912069 CTCATAATAAAGGCCTACCTTGG - Intronic
1032259229 7:130321555-130321577 CTGCTGATAAAGACATACCTGGG + Intronic
1033048406 7:137982716-137982738 CTGCTGATAAAGACATACCCAGG - Intronic
1033248915 7:139741934-139741956 ATGATAATAATGACCTCCCAGGG - Intronic
1033602592 7:142898961-142898983 CTGCTAAGACAGCCCTACCTTGG + Intergenic
1034321732 7:150190731-150190753 CTGCTAACAAAGACATACCCAGG + Intergenic
1034771015 7:153776546-153776568 CTGCTAACAAAGACATACCCAGG - Intergenic
1034921588 7:155087711-155087733 CTGCTAGAAAAGAACTACCTGGG - Intergenic
1035129135 7:156636060-156636082 CTGCTAATAAAGACATACCCGGG + Intergenic
1035796772 8:2364704-2364726 CTGCTAATAAAGACGTACCCAGG - Intergenic
1036086829 8:5621779-5621801 CTGCTCATAAAGACATACACAGG + Intergenic
1036123227 8:6040021-6040043 CTGCTAATAAAGACATACCGAGG - Intergenic
1037239974 8:16766103-16766125 CTGCTGATAAAGACATACCCCGG - Intergenic
1037448735 8:18995602-18995624 CTGCTATTAAAGACATGCCCGGG + Intronic
1041333847 8:56757882-56757904 CTGCTAATAAAGACATACCCTGG + Intergenic
1041825680 8:62094253-62094275 CTACTAATAAAGACATACCTGGG + Intergenic
1042384789 8:68161839-68161861 CTGCTAATAAAGACATACCCAGG + Intronic
1042660892 8:71153323-71153345 CTGCTGATAAAGACATACCTGGG + Intergenic
1042761650 8:72277480-72277502 CTGCTAATAAAGACATACCTAGG - Intergenic
1044020784 8:87103437-87103459 GTGCTAATAAAGACATACCTAGG + Intronic
1044553831 8:93540740-93540762 CTGCTTATAAAGACTTTCAATGG - Intergenic
1045530528 8:102981052-102981074 CTGCTTATAAAGATGTACCTAGG + Intergenic
1046061506 8:109145069-109145091 CTGCTGATAAAGACATACCCAGG - Intergenic
1046349617 8:112990142-112990164 CTGCTAATAAAGACGTATTCGGG - Intronic
1046563543 8:115869217-115869239 CTGCTGATAAAGACATACCCGGG - Intergenic
1046630993 8:116623079-116623101 CTGCTAATAAAGATATACCCAGG - Intergenic
1047115856 8:121841356-121841378 CTGCTAAGAAAGACATACCTGGG - Intergenic
1047318574 8:123756949-123756971 CTGCTGATAAAGACATACCCAGG + Intergenic
1048122069 8:131592674-131592696 CTGCTGATAAAGACATACCCAGG - Intergenic
1048652502 8:136494712-136494734 CTGCTAATGAAGACATACCCAGG + Intergenic
1048895626 8:138989858-138989880 CTGCTGATAAAGACATACCTAGG + Intergenic
1049141136 8:140955484-140955506 CTGCTAATAAAGACATACTTGGG - Intronic
1050319702 9:4438888-4438910 CTGCTAATAAAGACATACCTAGG - Intergenic
1051954597 9:22676303-22676325 CTGCTAATAAATACCTCAGAAGG - Intergenic
1052062927 9:23983282-23983304 CTGCTAATAAAGACATTCCTGGG + Intergenic
1052452998 9:28655882-28655904 TTGCTAATAAAGACATACCTGGG - Intronic
1052629907 9:31024124-31024146 TTGCTAATAAAATCCTACCCTGG + Intergenic
1056249683 9:84734815-84734837 CTGCTAATAAAGACATACGCAGG - Intronic
1057780660 9:98047345-98047367 CTGCTGATAAAGACACACCCAGG - Intergenic
1058246039 9:102626396-102626418 CTGCTAATAAAGACATATCCAGG + Intergenic
1059403780 9:114087371-114087393 CTGCTAATAAAGACATACCCAGG + Intronic
1059490747 9:114665585-114665607 CTGTTAATAAAGATATACCTTGG + Intergenic
1060021990 9:120139749-120139771 ATGCTGATAAAGACATACCTAGG + Intergenic
1060255062 9:122020053-122020075 CTGCTGTTAAAGACATACCTGGG - Intronic
1060313948 9:122490827-122490849 CTGCTGATCAAGTCCTTCCATGG - Intergenic
1061436009 9:130562565-130562587 CTACTAATAAAGACATACCCAGG + Intergenic
1203369192 Un_KI270442v1:286897-286919 CTGCTAATAAAGACATATCTGGG - Intergenic
1203636927 Un_KI270750v1:121644-121666 CTGCTAATAAAGACATACCTGGG + Intergenic
1185691433 X:2158342-2158364 CTGCTGATAATGACATACCTGGG - Intergenic
1185958389 X:4518227-4518249 CTGTTAATAAAGACGTACCCAGG - Intergenic
1185969564 X:4647535-4647557 TTGCTAATAAAGACATACCCAGG + Intergenic
1187663322 X:21574377-21574399 CTGCTAATAAAGACATACCCAGG + Intronic
1187721902 X:22160103-22160125 CTGCTAATAAAGACATACCTGGG + Intronic
1187748217 X:22432592-22432614 CTCCTAATAAAGACATTACAAGG - Intergenic
1189870270 X:45374171-45374193 TTTCTAATCAAGACATACCATGG + Intergenic
1191599022 X:62983019-62983041 CTGCTAATAAAGACATATCCAGG + Intergenic
1192499188 X:71637822-71637844 GTGGGAATATAGACCTACCAGGG - Intergenic
1192846451 X:74910959-74910981 CTGCTGATAAAGACATACCTGGG - Intronic
1192932924 X:75826784-75826806 CTGCTAACAAAGACATACTCAGG + Intergenic
1194489478 X:94529087-94529109 CTGCTAATAAAGGCATAGCCAGG + Intergenic
1194548638 X:95269777-95269799 CTGCTAATAAAGACATACCTTGG + Intergenic
1194756467 X:97744440-97744462 CTGCTAATAAAGACATATCCAGG - Intergenic
1196277519 X:113784790-113784812 CTGCTAATAAAGACATACCTGGG + Intergenic
1196390326 X:115200972-115200994 CTGCTGATAAAGACATACCTGGG + Intronic
1198673826 X:139110613-139110635 CTGCTGATAAAGACATACCCGGG - Intronic
1198816463 X:140596869-140596891 CTACTAATTAAGCACTACCAGGG + Intergenic
1199106465 X:143874919-143874941 CTTCTGATAAAGACATACCCAGG - Intergenic
1199222956 X:145339088-145339110 CTGCTAATAAAAACATACCCAGG + Intergenic
1199909270 X:152268534-152268556 CTGCTAATAAAGACATACCCAGG - Intronic