ID: 1141440007

View in Genome Browser
Species Human (GRCh38)
Location 16:84024124-84024146
Sequence ACCCAAAATGTCTGCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 6, 2: 36, 3: 79, 4: 255}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141440004_1141440007 -8 Left 1141440004 16:84024109-84024131 CCCCAAGTTGTGACAACCCAAAA 0: 5
1: 31
2: 204
3: 500
4: 870
Right 1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG 0: 1
1: 6
2: 36
3: 79
4: 255
1141440006_1141440007 -10 Left 1141440006 16:84024111-84024133 CCAAGTTGTGACAACCCAAAATG 0: 9
1: 163
2: 528
3: 800
4: 1167
Right 1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG 0: 1
1: 6
2: 36
3: 79
4: 255
1141440005_1141440007 -9 Left 1141440005 16:84024110-84024132 CCCAAGTTGTGACAACCCAAAAT 0: 5
1: 51
2: 277
3: 608
4: 986
Right 1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG 0: 1
1: 6
2: 36
3: 79
4: 255
1141440001_1141440007 -3 Left 1141440001 16:84024104-84024126 CCCTCCCCCAAGTTGTGACAACC 0: 3
1: 21
2: 76
3: 214
4: 618
Right 1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG 0: 1
1: 6
2: 36
3: 79
4: 255
1141439996_1141440007 21 Left 1141439996 16:84024080-84024102 CCTACTACATGCCAGTAACAGCC No data
Right 1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG 0: 1
1: 6
2: 36
3: 79
4: 255
1141439998_1141440007 0 Left 1141439998 16:84024101-84024123 CCCCCCTCCCCCAAGTTGTGACA No data
Right 1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG 0: 1
1: 6
2: 36
3: 79
4: 255
1141440000_1141440007 -2 Left 1141440000 16:84024103-84024125 CCCCTCCCCCAAGTTGTGACAAC 0: 3
1: 15
2: 48
3: 158
4: 469
Right 1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG 0: 1
1: 6
2: 36
3: 79
4: 255
1141439999_1141440007 -1 Left 1141439999 16:84024102-84024124 CCCCCTCCCCCAAGTTGTGACAA 0: 5
1: 5
2: 32
3: 120
4: 397
Right 1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG 0: 1
1: 6
2: 36
3: 79
4: 255
1141439995_1141440007 27 Left 1141439995 16:84024074-84024096 CCGGGACCTACTACATGCCAGTA 0: 1
1: 0
2: 8
3: 80
4: 542
Right 1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG 0: 1
1: 6
2: 36
3: 79
4: 255
1141440003_1141440007 -7 Left 1141440003 16:84024108-84024130 CCCCCAAGTTGTGACAACCCAAA 0: 3
1: 20
2: 150
3: 334
4: 731
Right 1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG 0: 1
1: 6
2: 36
3: 79
4: 255
1141439997_1141440007 10 Left 1141439997 16:84024091-84024113 CCAGTAACAGCCCCCCTCCCCCA 0: 1
1: 2
2: 4
3: 62
4: 468
Right 1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG 0: 1
1: 6
2: 36
3: 79
4: 255
1141440002_1141440007 -4 Left 1141440002 16:84024105-84024127 CCTCCCCCAAGTTGTGACAACCC 0: 1
1: 7
2: 44
3: 164
4: 493
Right 1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG 0: 1
1: 6
2: 36
3: 79
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141440007 Original CRISPR ACCCAAAATGTCTGCAGACA TGG Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901040478 1:6360260-6360282 ACCCAAAATGTCTGCCCGGAGGG + Intronic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902110790 1:14076603-14076625 ACCCAAAATGCTTCCAGATATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902675285 1:18004503-18004525 ACTGCAAATGTCTGCTGACAGGG - Intergenic
905302744 1:36996892-36996914 ACCAAAAATGTCTTCCGTCATGG - Intronic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
907213757 1:52844206-52844228 ACCCAAAATTTATGGAGAGAAGG + Intronic
907364616 1:53947576-53947598 ACCAAAAGTGTCTGCAGCCTTGG + Intronic
909018448 1:70404944-70404966 ACTCAACATGTCTGCTGACTTGG + Intergenic
909296057 1:73950345-73950367 GCCCAAAATGGCTACAGTCAGGG - Intergenic
909423613 1:75495007-75495029 ACCCAGAATCTCTGAAGACTGGG + Intronic
910324042 1:85983524-85983546 ACCCAAATTGTTTGCAAATAGGG + Intronic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
911736322 1:101340371-101340393 ACCCAAAATATCCACAGATATGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
914330889 1:146670253-146670275 ACCCAGACTCTCTGCAAACATGG - Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
917140577 1:171831089-171831111 ATCCAATATTTCTGCAGCCAAGG - Intergenic
917425711 1:174910787-174910809 ACCCAAAATAACTGAAAACAGGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
920682004 1:208080413-208080435 ACTCAAAATCTCAGCAGGCAAGG - Intronic
920854422 1:209651613-209651635 ACCCAAAATGTCTTCAATGATGG + Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
922271767 1:224042079-224042101 ACCCAAAAAGTCTACAAAAATGG - Intergenic
924252228 1:242144204-242144226 AACCAAAATTTCTGCAGGCTGGG + Intronic
924252237 1:242144280-242144302 AACCAAAATTTCTGCAGGCTGGG + Intronic
924388983 1:243530250-243530272 AACCATACTGTCTGCAAACATGG + Intronic
924910218 1:248502761-248502783 ACCCAAAATATATGAAGCCAAGG - Intergenic
924913883 1:248545277-248545299 ACCCAAAATATATGAAGCCAAGG + Intergenic
1062984196 10:1752312-1752334 CCCCAACATTTCTGCATACATGG - Intergenic
1063164311 10:3446079-3446101 GCCCAGGATCTCTGCAGACAGGG - Intergenic
1065382887 10:25107761-25107783 ACCCAGAATGTCTGCAGGAGAGG - Intergenic
1065876305 10:30000276-30000298 AACCAAAAGGACTGCAGGCAAGG - Intergenic
1068406067 10:56590580-56590602 AACTAAAATGTCTTCAGACTTGG + Intergenic
1069054863 10:63834171-63834193 TGCCAAAATGTTTGCAAACACGG - Intergenic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1071415449 10:85437050-85437072 ATCCAAAATGTCTGCAGGAATGG - Intergenic
1072346976 10:94517521-94517543 ACCTAATAAGTCTGCAGCCAGGG - Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1075067810 10:119301433-119301455 ACCCACTATGTGTGGAGACAGGG - Intronic
1075505239 10:123015517-123015539 ACCCAAAATGTCTCCATCCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076803827 10:132845334-132845356 TCCAGAGATGTCTGCAGACATGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1079559989 11:21810419-21810441 CCCCATAATGTATGCAGAGATGG - Intergenic
1081522064 11:43891669-43891691 GCCACAAATTTCTGCAGACAGGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1081626093 11:44656077-44656099 ACCCAACACTTCTGCAGATAAGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1086223680 11:84481582-84481604 ACCCACAATGTCTTCAGAAGTGG + Intronic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087518329 11:99196361-99196383 ACCCAAAATCTCTAAAGAAAAGG - Intronic
1087951935 11:104231698-104231720 ACCCAAATTATCTGTAGTCAAGG - Intergenic
1088146255 11:106683574-106683596 ACCCAGAATGGCTACAGAAAGGG - Intronic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1089182155 11:116590503-116590525 TCCCAAAATGTCTGCCACCAAGG + Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094090319 12:26642788-26642810 ACCCAAAATGTTTCCAATCAGGG + Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1097550193 12:61058467-61058489 AGTCATATTGTCTGCAGACAAGG + Intergenic
1098815420 12:75155146-75155168 GCCAAAAATTTCTGCAGGCATGG - Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1102908895 12:116697534-116697556 ACCCCGAATGTCTCCAGACATGG - Intergenic
1103443907 12:120981537-120981559 AGCCAAAATGACTGCAGCAAAGG - Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1105023268 12:132831798-132831820 AACCAAAATGTCCTCTGACATGG + Intronic
1105278584 13:18950196-18950218 ACCCAAGATGAGGGCAGACAGGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1110760382 13:79224460-79224482 ATCCAATGTGTCTGCAAACAGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115300621 14:31881246-31881268 AGCCAGGATGTCAGCAGACAGGG - Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1117625093 14:57628084-57628106 ACCAAAAATGTACGTAGACAAGG - Intronic
1117995621 14:61475015-61475037 ACCCAAAATATCTTCCCACATGG + Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1121407639 14:93728633-93728655 ACCCAGCATGTCTGGAGAGATGG + Intronic
1121520340 14:94581791-94581813 ACCAAATGTGTCTGCAGACATGG - Intronic
1122390518 14:101378649-101378671 ACCCAAAAGGTATCCAGAAATGG + Intergenic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1125276417 15:37996773-37996795 GTCCAAAATGTCTTCAGACCTGG + Intergenic
1127942366 15:63712064-63712086 ACCCTAAATGCCTGCAGTCCAGG + Intronic
1129051638 15:72786047-72786069 ACCCAAATTGCTTCCAGACATGG + Intergenic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130888385 15:88112554-88112576 GCCCTACTTGTCTGCAGACAGGG - Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1131529319 15:93178660-93178682 AGCCTAAATGTCTCCAGCCACGG - Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133718731 16:8474451-8474473 TCCCAAAATGTCTGCACCGACGG + Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1134009218 16:10838875-10838897 ATGCAGAATGTCTCCAGACATGG + Intergenic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135060350 16:19266292-19266314 ACCCCAAATGTCTTCGGACATGG - Intronic
1135078653 16:19415386-19415408 ACCAAAAATGTCTTCAGGAATGG - Intronic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135509924 16:23073562-23073584 AACTAAAATGACTGCAGTCAAGG - Intronic
1136067754 16:27770199-27770221 AACCCAAATGTCCCCAGACAAGG - Intronic
1136572909 16:31107471-31107493 ACTCTAAATCACTGCAGACAAGG + Intronic
1136933877 16:34440895-34440917 AGCCAATATGTCAGGAGACAAGG - Intergenic
1136970695 16:34970919-34970941 AGCCAATATGTCAGGAGACAAGG + Intergenic
1137392501 16:48093057-48093079 ACCCAATCTGTCTCTAGACATGG - Intronic
1137968160 16:52957341-52957363 ACCCAGAAAGTGTGAAGACAGGG + Intergenic
1139255227 16:65534663-65534685 ACCAAGAATCTCTTCAGACAGGG + Intergenic
1140002665 16:71040653-71040675 ACCCAGACTCTCTGCAAACATGG + Intronic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1143317837 17:6046080-6046102 AACCAAAATATCTCCAGGCATGG - Intronic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1144771019 17:17759629-17759651 CCCCGAAATATGTGCAGACATGG - Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150480108 17:65502686-65502708 AGCCTAAATGTCTGCAAATAGGG + Intergenic
1151062680 17:71114252-71114274 AACCAGAATGTCTGGAGACTAGG - Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1151495934 17:74458101-74458123 ACCTAAGCTCTCTGCAGACAAGG - Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1153087888 18:1309136-1309158 ACTCAATAGGTCTGAAGACAGGG + Intergenic
1153640857 18:7155837-7155859 AACCAACATGTCTGCACTCAGGG + Intergenic
1154054971 18:11004074-11004096 AAAGAAAATGTCTGCAGTCAGGG - Intronic
1156545516 18:37960298-37960320 AGCCATAATGTCTGGAAACAGGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158831673 18:61286421-61286443 ACCCAAAATCTGTGCAGGTATGG + Intergenic
1160600012 18:80005291-80005313 ACCCAGGCTGTCTGCAGACTTGG + Intronic
1160615191 18:80120966-80120988 ACCCAAAATAACTGAAAACAGGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163333349 19:16655741-16655763 ACCCGAAGTATCTGCAGACTGGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1164154911 19:22587578-22587600 ACCCAAAATGTGTACACACAAGG + Intergenic
1164460079 19:28439352-28439374 ACCTAGAATGTCTCCAGGCATGG - Intergenic
1164536239 19:29088202-29088224 CCCCAAGATGGCTTCAGACAAGG - Intergenic
1164672479 19:30080622-30080644 AACCAGAAGGTTTGCAGACAGGG + Intergenic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1166677739 19:44749547-44749569 AACCAAGATATCTGGAGACATGG + Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168633920 19:57979905-57979927 AGCCATAATGTATGCAGATAAGG - Exonic
927262006 2:21101438-21101460 AATCAAAATGTCTCAAGACATGG - Intergenic
927422667 2:22949355-22949377 ACTCAACATCTCTGCAAACAAGG + Intergenic
927541629 2:23917110-23917132 ACCAAAAATGTTTGCCCACATGG + Intronic
929085714 2:38165314-38165336 AACCAAAAAGTCTCCAGACATGG - Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930934990 2:56938048-56938070 ACCCAAAACGTTTTCAGATATGG - Intergenic
932580806 2:72991622-72991644 ACCCAAGATGGCTGCAGACCAGG + Intronic
935133206 2:100276901-100276923 GCACACAATGTCTGCAGACAGGG + Exonic
935502447 2:103857878-103857900 ACCAAAAATCACTGCAGTCATGG - Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937330252 2:121022179-121022201 ACCAAAAATGTCTATGGACATGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937886224 2:126901574-126901596 CCCCAATATGTCTGCATATATGG - Intronic
937954237 2:127410895-127410917 AACCAAAATGTCACCAGAAAAGG - Intergenic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
942742022 2:179192097-179192119 AACCAGAATGTCTCTAGACATGG + Intronic
945052977 2:205843086-205843108 AAACAAAATGTGTGCAGGCAAGG - Intergenic
945180958 2:207090639-207090661 ACCCAGCATGTCTGTAGACTTGG - Intronic
946682446 2:222231244-222231266 ACACACAATATTTGCAGACAAGG + Intronic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948576301 2:238952553-238952575 AACCAAAATGTCCACTGACATGG - Intergenic
1169189991 20:3652533-3652555 AGTCAAAAAGTCAGCAGACATGG - Intergenic
1169560967 20:6800348-6800370 ACATAAACTGTCTGCAGAAAAGG + Intergenic
1169847191 20:10007195-10007217 CCCCAAAAAATCTGCAGCCATGG + Intronic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1172297640 20:33824667-33824689 GTCCAAAATGTCAGCAGTCAAGG - Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1174427533 20:50443171-50443193 ACAGAAAAAGTCTGCAGATATGG - Intergenic
1174489591 20:50883457-50883479 CCCCACAATGTCTGCTTACAGGG + Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1175045244 20:56098937-56098959 ACCCAAAAGTTCTGCACACCTGG + Intergenic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175545619 20:59775974-59775996 ATCTAAAATGTCTCCAGACTTGG + Intronic
1176289561 21:5036922-5036944 ACCCAAAATGCCTCCAGACCTGG - Intronic
1178171226 21:30041768-30041790 ACACAAAATGACTTAAGACATGG - Intergenic
1179009669 21:37546593-37546615 CCTCATAATGTCTGAAGACACGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179117972 21:38511889-38511911 ACCAAAACTGTCTTTAGACATGG + Intronic
1179143623 21:38748905-38748927 AGCAAAAATGACTGCAGGCAAGG - Intergenic
1179867669 21:44226665-44226687 ACCCAAAATGCCTCCAGACCTGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
949106976 3:211111-211133 ACCCCAAATGTCAGGAAACAAGG + Intronic
951064269 3:18246232-18246254 ACCCAAAATAACTGAAAACAGGG - Intronic
951284160 3:20788891-20788913 ACCGAAAAGGTCTTCAAACATGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953696610 3:45164831-45164853 ACCCAAAGTGTCTGGGGGCAAGG - Intergenic
953732289 3:45460327-45460349 ACCCCAACTGTCAGCAGACAGGG - Intronic
954122287 3:48506406-48506428 ACAGAAAATGCCTGCACACATGG - Intergenic
955607609 3:60722630-60722652 CAACAAAATGTCTTCAGACATGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
958636746 3:96755040-96755062 ACCCAAATTCTCTGGAAACAAGG - Intergenic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961177240 3:124845761-124845783 ACCCTATCTGTCTGGAGACAGGG + Intronic
961227510 3:125265516-125265538 AAACAAAATGTCTGCAGAACAGG + Intronic
961593987 3:128002042-128002064 CCTCAAAAACTCTGCAGACAAGG + Intergenic
961739429 3:129023753-129023775 ACCAAAAATGTCTGCAGCTTAGG + Intronic
961865258 3:129949172-129949194 ACCCCAAATGTCTTCCCACAGGG - Intergenic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
964149127 3:153502913-153502935 AAACAAAATCTCTGCAGTCATGG + Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964272533 3:154973256-154973278 ACCCAAAATGGGTGCAGATGTGG - Intergenic
964515443 3:157503083-157503105 AACCGAAATGCCTGCATACATGG + Intronic
965314835 3:167178628-167178650 ACCCAAATTGGCTGCTGATAAGG + Intergenic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
971258336 4:25033193-25033215 ACCCCAAATATCTCCACACATGG - Intergenic
975818577 4:78245939-78245961 ACCAGAAATCTTTGCAGACATGG + Intronic
975997198 4:80329740-80329762 ACTCAAGATTTCTGCAGCCATGG - Intronic
976114340 4:81710946-81710968 ACCCTAAATGTTTGTAGACTTGG + Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
978403757 4:108358685-108358707 ACCAAAAATGTCTTAAGTCATGG - Intergenic
979381438 4:120011376-120011398 ACCTGAAATGTCTGAAGTCAAGG - Intergenic
979596476 4:122540540-122540562 ACCCAAACAAGCTGCAGACATGG + Intergenic
981002501 4:139841244-139841266 GCCCAAAAGGTCTGCAGAGAGGG - Intronic
983010944 4:162546354-162546376 AACCATATTGTCTGCAAACAGGG + Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985768217 5:1792779-1792801 TCCCCAAATCTCTGCACACACGG + Intergenic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988745424 5:34130778-34130800 ACCCAAAATGTATACACACAAGG + Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
990934751 5:61136075-61136097 ATCCTAAATGTTTGCAAACAGGG - Intronic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993056570 5:82988287-82988309 TCCCCAAATGTCTATAGACAAGG + Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994202032 5:96988092-96988114 TCCCAAAATGTATGCAGTCTTGG + Intronic
996193441 5:120573729-120573751 ACTCAAAATGTCTGCAGCCATGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
999087217 5:148903626-148903648 CCCCAACAGGTCTCCAGACAAGG - Intergenic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002286588 5:178166425-178166447 ACCCAAAAAGTCTGCAACCCAGG + Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1003877489 6:10451373-10451395 ACCCAGAAGGTCTCCAAACATGG - Intergenic
1003967420 6:11266278-11266300 ATCCAAAATGTCTCCAGATATGG - Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005941320 6:30562402-30562424 TGGCAAAATGTCGGCAGACAGGG - Exonic
1006024755 6:31139693-31139715 ACCCAGGATGACTGCAGAAAAGG + Exonic
1006529833 6:34642410-34642432 ACCCAGATTAGCTGCAGACAAGG + Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009014369 6:57880699-57880721 ACCCAAAATGTATACACAGAAGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009292273 6:61897219-61897241 AACCACAATCTCTGGAGACAGGG + Intronic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1016421364 6:143886818-143886840 ACCCAAAATGTCTACACACCTGG - Exonic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020448689 7:8297663-8297685 ACCCAAACTATCCGCACACATGG + Intergenic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1023583721 7:41707343-41707365 AACCAAAATGTCTTCAAACATGG - Intergenic
1024241677 7:47440573-47440595 ACCCAATGTGACTGGAGACAAGG + Intronic
1024516514 7:50263831-50263853 ACCTATGATGTGTGCAGACATGG + Intergenic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1029460442 7:100691204-100691226 ACCCAGAATGTCTCTAGACTTGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1030846087 7:114413674-114413696 ACCCAAAATGTCTGTATTAAAGG + Intronic
1030926687 7:115465839-115465861 ACTCGAAAAGTTTGCAGACATGG - Intergenic
1031515279 7:122691830-122691852 CCCCAGAATGTCTCCAGGCATGG + Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1033425920 7:141244004-141244026 CCCCAAAATGTCCGCAGCCCCGG - Intronic
1034735702 7:153427461-153427483 TCCCAAAGTGTCTGCTGAGAAGG - Intergenic
1034935234 7:155194969-155194991 ATCCAAACTGTCCCCAGACATGG - Intergenic
1035405406 7:158593896-158593918 ACCCCAAATGTCTGAAGAATTGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1039208583 8:35185176-35185198 AACTAAAATGTCTTCAGTCAAGG + Intergenic
1039461034 8:37744508-37744530 ACTCAAAATGCCCTCAGACACGG - Intronic
1041118522 8:54563942-54563964 AGCCAACATTTCTGCTGACACGG - Intergenic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1047043762 8:121028237-121028259 ACCAAAAATATCTGGAGATATGG - Intergenic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050259473 9:3826370-3826392 ACCCACAAAGTCTGCAGGAAGGG + Intronic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1054758025 9:68978579-68978601 AACCAAAAAGTAAGCAGACATGG - Intronic
1054850194 9:69839714-69839736 AACCAAAATTTGTCCAGACATGG - Intronic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056827209 9:89884560-89884582 ACACAGATTGTCTCCAGACAGGG - Intergenic
1057274371 9:93668527-93668549 ACCCAAGATGAGGGCAGACAGGG + Intronic
1057936904 9:99247917-99247939 AACCACAATGACAGCAGACACGG - Intergenic
1059821641 9:117980152-117980174 GCACAAAATGTGTGCACACAAGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060120433 9:120984143-120984165 AACCTAAATGTCTACAGAAAGGG - Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060699700 9:125740067-125740089 AGCCTAGGTGTCTGCAGACATGG - Intergenic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1062609465 9:137367495-137367517 ACCCACAGTGTCTGCAGGGATGG - Intronic
1185486537 X:485521-485543 AACCAGGATGTCTGCAGACCAGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186780642 X:12908567-12908589 AACCAAAATCTCTGGATACAGGG + Intronic
1186868484 X:13745646-13745668 ACCCAAAAAGTATGCACAGAGGG - Intronic
1187339979 X:18412323-18412345 ATCCAAAATGCCTCCAGACAAGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187767622 X:22660735-22660757 ATCCAGAATTTCTGCAAACAGGG - Intergenic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1188726260 X:33586934-33586956 ACCCAAAGTGACTGCTGGCAGGG - Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190693141 X:52928890-52928912 ACCCAAAAGAACTGCAGTCAGGG - Intronic
1192745948 X:73939104-73939126 ACCCAAGATATCTGCAAACGTGG + Intergenic
1193031859 X:76907253-76907275 ACTCCAAATGTCTGGAGATATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1198011766 X:132563865-132563887 ACCCTTAATGTCTGTAGTCAGGG + Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic