ID: 1141440225

View in Genome Browser
Species Human (GRCh38)
Location 16:84025337-84025359
Sequence CAGCAGTAGCAAAGGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141440225_1141440229 -9 Left 1141440225 16:84025337-84025359 CCTCAGGGCCTTTGCTACTGCTG No data
Right 1141440229 16:84025351-84025373 CTACTGCTGGTCCCTCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141440225 Original CRISPR CAGCAGTAGCAAAGGCCCTG AGG (reversed) Intronic
No off target data available for this crispr