ID: 1141443170

View in Genome Browser
Species Human (GRCh38)
Location 16:84042388-84042410
Sequence AGGTTGCCTTGGGGTCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141443170 Original CRISPR AGGTTGCCTTGGGGTCTAGT GGG (reversed) Intronic
902055255 1:13595451-13595473 AGTTTGCTTTGGGGTCTTGGGGG - Intronic
902394559 1:16125448-16125470 AGGGTGCCTTGGGGACCTGTAGG + Intronic
902953744 1:19909747-19909769 AGGTGGCCTTGGGCCCTATTGGG + Exonic
905305953 1:37018281-37018303 AAGATGCCTTGGGACCTAGTGGG - Intronic
912680608 1:111726767-111726789 AGGCTGTCTTGGGGGCTAGCTGG - Exonic
917096384 1:171403233-171403255 CGGTTTCCTTGGGCTCAAGTTGG - Intergenic
917212947 1:172648388-172648410 AAGTTGCCATGGGATCCAGTTGG + Intergenic
919868707 1:201803892-201803914 GGGTGGCCTTGGGGACAAGTAGG - Intronic
1067837330 10:49649692-49649714 AGGGAGCCTTGGGAGCTAGTAGG - Intronic
1068660723 10:59620691-59620713 ATGTTGCCATGAGATCTAGTAGG + Intergenic
1069529316 10:69204290-69204312 AGGAGGCCTTTGGGTTTAGTGGG - Intronic
1071308314 10:84319617-84319639 TGGTTGCCTTGGGGGCAAATGGG - Intergenic
1071471478 10:85987088-85987110 AGGCTGCCCTGGGGTCTGCTAGG - Intronic
1075475051 10:122727321-122727343 ATCTTGCCTTGGTGTGTAGTTGG - Intergenic
1075565603 10:123501677-123501699 AGTTTGCCTTGGGGCATGGTGGG - Intergenic
1078074895 11:8149697-8149719 AGGTTACTTTGGGGTCCCGTTGG - Intronic
1079017711 11:16883560-16883582 AGGATGACTTGGGGACTGGTGGG - Intronic
1079052379 11:17173543-17173565 AGGTTGGCTTTGGGCTTAGTTGG - Intronic
1079196587 11:18333062-18333084 AGGTTGCCATGGTGGCTAGAAGG - Exonic
1079729664 11:23924104-23924126 AGGTTGGCTTGGGGTGGGGTGGG - Intergenic
1081775140 11:45671344-45671366 GGGCTGCCTTGGGGTCCAGCAGG - Intergenic
1085772219 11:79335843-79335865 AGGTTGCCTAGGGGTCTCAAAGG + Intronic
1087809045 11:102590465-102590487 AGGTTGGCTTGGGGCCAGGTTGG - Intronic
1089589085 11:119529145-119529167 AGGGTGCCTCGGGGTGTGGTGGG + Intergenic
1090034743 11:123238978-123239000 AGGATGGCTTGGAGTCGAGTGGG - Intergenic
1091330437 11:134727705-134727727 GGGTTGCCTTGGGCTCCAGCAGG - Intergenic
1093540045 12:20271546-20271568 ACGTTGCGTTGGGGTCAGGTTGG + Intergenic
1093820079 12:23604457-23604479 AGGTTGCCTTGGGGTATGCCTGG + Exonic
1094351423 12:29530184-29530206 AGGTTTCCCTGGGGTCTCCTTGG - Intronic
1095294255 12:40510491-40510513 TGATTACCTTGGGGACTAGTGGG - Intronic
1100571975 12:95851565-95851587 GGGTTGCCTATGGGTGTAGTGGG - Intergenic
1100769429 12:97905370-97905392 AGTTTGCCATGGGGTCTAATAGG + Intergenic
1102660235 12:114520630-114520652 AGGTGACCTTGGGGTTTACTGGG - Intergenic
1107380817 13:39855101-39855123 AGGTTTCCCTGGGGTCTTCTTGG - Intergenic
1108920103 13:55662316-55662338 AGGTTTCTTTGGGGTCTCCTTGG + Intergenic
1115853665 14:37606878-37606900 AGGCTGCCTATGGGTCTAGCAGG + Intronic
1115938589 14:38583359-38583381 AGGTTTCTTTGGGGTCTCATTGG - Intergenic
1118685121 14:68283324-68283346 AAGTTGCTTTGGTGTGTAGTTGG - Intronic
1128223539 15:65985330-65985352 AGGTGGCCTTGGGGACAAGGTGG + Intronic
1128233072 15:66048874-66048896 AGGCTGCCTTGAGGTCTGGAGGG - Intronic
1130138883 15:81206254-81206276 ATATAGCCTTGGGGTGTAGTAGG - Intronic
1134116620 16:11553498-11553520 AGGATGGCTTGGGGCCAAGTGGG + Intronic
1134463055 16:14446491-14446513 AGGTTGCCTGGGGGTTTTGCTGG + Intronic
1135514957 16:23124176-23124198 AGGTTTCTTTTGGGGCTAGTGGG - Intronic
1141443170 16:84042388-84042410 AGGTTGCCTTGGGGTCTAGTGGG - Intronic
1142249672 16:88985604-88985626 AGGTTGCCCCGGGGTCTGCTTGG + Intergenic
1143969865 17:10787721-10787743 AGGTGGAGGTGGGGTCTAGTAGG + Intergenic
1147187684 17:38721758-38721780 AGGGTGCCTGGGGGTGAAGTGGG + Intronic
1151254480 17:72865169-72865191 AGGTTGCCTTGGGGTGAATATGG + Intronic
1151618205 17:75228555-75228577 AGGTTGAATTGGGGTCTTGTGGG + Intronic
1158745642 18:60196541-60196563 AGGTTGCCATGGTGGCTAGAAGG - Intergenic
1159023030 18:63158464-63158486 AGGCTGCCTGGGGGTCTCGGAGG - Intronic
1159654560 18:71016713-71016735 ATGTAGCCTTGGTGTGTAGTAGG + Intergenic
1162451151 19:10756032-10756054 AGGTGGCCTGGGGCTCTGGTAGG + Intronic
1162852585 19:13442127-13442149 TTTTTGCCTTGGGGTCTACTCGG - Intronic
1163616045 19:18329113-18329135 AGGTTTCCTGGGGCTCTATTTGG + Intergenic
1164709805 19:30347654-30347676 AGAATGTCTTGGTGTCTAGTAGG + Intronic
1165108067 19:33486240-33486262 GGGTTGGTTTGGGGGCTAGTGGG - Intronic
1166257865 19:41619134-41619156 AGGTTGCCCTGGGCTCTGGGTGG - Exonic
928895082 2:36252140-36252162 AGGTTGCCTTGGGGCGGAGTGGG + Intergenic
931656820 2:64517082-64517104 AGCTTGCCCTGGGGTATAGGAGG - Intergenic
931988798 2:67768652-67768674 TGGATGCCTTGGGTTGTAGTTGG - Intergenic
932165067 2:69498402-69498424 AGGATGCTCTGGGGTCTACTGGG + Intronic
935958330 2:108400220-108400242 AGATTGCCCTGGGGTCTGGGTGG - Intergenic
944711265 2:202336752-202336774 TGGTTGTGTCGGGGTCTAGTGGG - Intergenic
945538340 2:211049269-211049291 AGGAGGTCTTGGGGTCTTGTTGG - Intergenic
947551163 2:231047793-231047815 CTGTTGCCTTGGGGGCTTGTCGG + Exonic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1174051698 20:47771621-47771643 AGGTTGCCCTGGAGTCCAGGAGG + Intronic
1175780436 20:61679031-61679053 AGGTTGCCTAGGGTTCCGGTTGG + Intronic
1177852514 21:26365486-26365508 AGGTAGCCTAGGTGTGTAGTAGG - Intergenic
1178806124 21:35841080-35841102 AGGTTGCTTTGAGGTCTCCTGGG - Intronic
1179309504 21:40183281-40183303 AGGTGGCCTTGGGTCCTTGTAGG + Intronic
1179621029 21:42616607-42616629 AGGTTGCCTGAGGCTCCAGTAGG - Intergenic
1179886048 21:44314652-44314674 TGGTTCCCTTGGGGTGGAGTTGG + Intronic
1182667515 22:31970564-31970586 AGGCTGCCAGGGGGTCTAATGGG + Intergenic
1184114126 22:42412364-42412386 ACTTTGCCTTGGGGTATATTAGG - Intronic
1184457598 22:44620545-44620567 AGGTTGCCATGGCGACTAATCGG + Intergenic
1184767734 22:46580330-46580352 AGGCTGGCTTGGGGTCTCTTTGG + Intronic
1203237284 22_KI270732v1_random:17477-17499 AGTTTTCCACGGGGTCTAGTCGG - Intergenic
954867076 3:53738835-53738857 AGGTTGCCTTGTAGACTTGTGGG + Intronic
956337190 3:68177225-68177247 AGCATGCCTTGGTGTCTACTTGG - Intronic
959016895 3:101144989-101145011 TGGTTGCCTTTGGGTCAGGTGGG - Intergenic
972360031 4:38318248-38318270 ACGTTCTCTTGGGGTCTAGATGG + Intergenic
976885433 4:89978027-89978049 AGGTTTCTTTGGGGTCTCCTTGG - Intergenic
984273523 4:177578005-177578027 ATATAGCCTTGGGGTGTAGTAGG + Intergenic
985778909 5:1859445-1859467 ACGTTGCCTTGGTCTCTAGAAGG - Intergenic
985923926 5:3000870-3000892 AATTTGCCTTGGGGTCTGGGAGG + Intergenic
988814629 5:34822490-34822512 AGCTTGCTTTGGGTTCTATTGGG - Intronic
995980516 5:118097296-118097318 AGGTTGGTGTGGGGCCTAGTAGG - Intergenic
998142015 5:139705360-139705382 TGAGTGCCTTGGGGTCTAATTGG - Intergenic
999303812 5:150507318-150507340 AGGTTGCCTTGTGCTCTCCTTGG + Intronic
1000131946 5:158308785-158308807 AGGATGCTTTGGGTTCTGGTGGG + Intergenic
1001065859 5:168534702-168534724 GGGTTGCCTTGGAGTCGAGGGGG + Intergenic
1001859459 5:175040803-175040825 AGCTCTCCTTGGGGTCTTGTTGG + Intergenic
1002272477 5:178081763-178081785 AGGCTGCCTTGGGCTCCAGGTGG + Intergenic
1002528535 5:179829328-179829350 AGGGTGCCTGGGGGTCTGGCAGG - Intronic
1005030701 6:21506256-21506278 TGGTTGTATTGTGGTCTAGTAGG - Intergenic
1014241825 6:119026521-119026543 AGGTTTCTTTGGGGTCCACTTGG - Intronic
1018298993 6:162379690-162379712 AGGTTTCCTTGGCGTCTCCTGGG + Intronic
1019568772 7:1698167-1698189 AGGTTCCCTTGGAATCTAATCGG - Intronic
1019747767 7:2710044-2710066 AGGTTGCAGCGGGGTCGAGTGGG + Intronic
1021166025 7:17342629-17342651 AGATTGCCTTTGGGTCAGGTAGG - Intronic
1022974784 7:35547050-35547072 AGGGTGCCTTGCAGTCTGGTAGG - Intergenic
1026419983 7:70224911-70224933 ATGTTGCCTAGGTGTATAGTAGG + Intronic
1026888238 7:73967112-73967134 AGGGTGTCTGGGGGTCTTGTTGG - Intergenic
1030744857 7:113152686-113152708 TGTTTGAGTTGGGGTCTAGTGGG + Intergenic
1039099781 8:33928714-33928736 AGGTTGTCTTGGGGGATAATAGG + Intergenic
1046650345 8:116830749-116830771 TGGTTGCCTTGGGGTAATGTGGG - Intronic
1052083919 9:24240536-24240558 AGATTGCCATGGGGGCTAGAGGG - Intergenic
1052219162 9:25998530-25998552 AGGTTGTGGTGGGGTCTGGTAGG - Intergenic
1058172403 9:101698518-101698540 ATGTAGCCTAGGGGTGTAGTAGG - Intronic
1058942755 9:109829257-109829279 AGGTTGCCATGGGGTTTTATAGG - Intronic
1062371769 9:136242939-136242961 AGGTTGCCCTGGGGTCTCCTTGG - Intronic
1185725486 X:2417991-2418013 AGGTCACATTGAGGTCTAGTTGG - Intronic
1187261103 X:17686081-17686103 ATGATGCCTTGGGATCTTGTAGG - Intronic
1187631855 X:21181969-21181991 AGGATGCCTAGTGGTCTAGGAGG - Intergenic
1187740059 X:22345917-22345939 AGGTTACCTTGGGTTCTTGCAGG - Intergenic
1196510270 X:116500968-116500990 ATTTGGCCTTGGGGTGTAGTTGG - Intergenic