ID: 1141444101

View in Genome Browser
Species Human (GRCh38)
Location 16:84047131-84047153
Sequence ATAGAGAAACTGCTTGTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141444097_1141444101 5 Left 1141444097 16:84047103-84047125 CCTCGGATGGGAGACGGATGTCA No data
Right 1141444101 16:84047131-84047153 ATAGAGAAACTGCTTGTGGTCGG No data
1141444095_1141444101 13 Left 1141444095 16:84047095-84047117 CCAAAAGTCCTCGGATGGGAGAC No data
Right 1141444101 16:84047131-84047153 ATAGAGAAACTGCTTGTGGTCGG No data
1141444092_1141444101 20 Left 1141444092 16:84047088-84047110 CCAGGGACCAAAAGTCCTCGGAT No data
Right 1141444101 16:84047131-84047153 ATAGAGAAACTGCTTGTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141444101 Original CRISPR ATAGAGAAACTGCTTGTGGT CGG Intergenic
No off target data available for this crispr