ID: 1141447359

View in Genome Browser
Species Human (GRCh38)
Location 16:84069812-84069834
Sequence CCTCCTCCCACCACGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 338}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141447355_1141447359 1 Left 1141447355 16:84069788-84069810 CCAAGAGTTGCGGGAACAGTGGT 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1141447359 16:84069812-84069834 CCTCCTCCCACCACGGAGGCTGG 0: 1
1: 0
2: 3
3: 34
4: 338
1141447351_1141447359 26 Left 1141447351 16:84069763-84069785 CCACGAGAAGCTGAGCAACATCT 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1141447359 16:84069812-84069834 CCTCCTCCCACCACGGAGGCTGG 0: 1
1: 0
2: 3
3: 34
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141447359 Original CRISPR CCTCCTCCCACCACGGAGGC TGG Intronic
903035075 1:20487462-20487484 CCTCCTCCCCCCATGGATTCTGG - Intergenic
903625931 1:24730280-24730302 CCTCCCCCCACCATGGAGTTTGG - Intergenic
904688455 1:32276392-32276414 CGTCCTCCCACCACGGCTTCTGG - Exonic
905238442 1:36566275-36566297 GCTCCTCCCTCCACCCAGGCAGG + Intergenic
905269128 1:36775205-36775227 CCACCGCCCACCACAGAGGTAGG + Intergenic
905860799 1:41349887-41349909 CCCCCTCCCCACACGGAGGAGGG + Intergenic
906054493 1:42904589-42904611 GCTCCTCCCTCCAGGGAGGTAGG - Intergenic
906216465 1:44043802-44043824 GCTCCTCCCTCCACGGACTCAGG - Intergenic
907525997 1:55054461-55054483 GCCCCTCACACCACGGAGGGAGG - Intronic
909542154 1:76803224-76803246 CCTCTTCCCTCCCTGGAGGCTGG + Intergenic
909973319 1:82017026-82017048 GCTCCTCCCACCACGGAGCTGGG - Intergenic
911438723 1:97898141-97898163 CCTCCTCCCACCAGCCAGACTGG - Intronic
914050751 1:144128149-144128171 CTTCCACCCACCTGGGAGGCAGG + Intergenic
914128430 1:144837295-144837317 CTTCCACCCACCTGGGAGGCAGG - Intergenic
915471643 1:156129281-156129303 CCTCCCCCCACCAGGCAGGGAGG - Intronic
915645339 1:157267934-157267956 CCTGCTTCCACCACTGGGGCTGG + Intergenic
916199043 1:162252298-162252320 CCTCCTCCCAACATGCTGGCTGG + Intronic
916725217 1:167517253-167517275 TCTGCTCCCACCAGGGAGCCAGG - Intronic
920491028 1:206415490-206415512 CCTCCTCCCACCGAGGGGCCAGG + Intronic
922735806 1:227977805-227977827 TCACCTCCCACCATGGAGGAGGG - Intergenic
923147095 1:231205843-231205865 TCTCCTCCCACACCTGAGGCTGG - Intronic
924596262 1:245447559-245447581 CCGCCTCCCACCTCGAAGGGAGG - Intronic
1062991909 10:1827227-1827249 CTTCCTCCCAACATGGAGGCTGG - Intergenic
1065308314 10:24389711-24389733 CCTGCTGCTACCACTGAGGCTGG + Intronic
1066386031 10:34941894-34941916 CCTCCTCCCACCAGCTAGGCAGG - Intergenic
1066960400 10:42217270-42217292 CTTCCACCCACCTGGGAGGCAGG + Intergenic
1067080679 10:43210730-43210752 CCTCCTCCCACCCAGGATGTAGG + Intronic
1067669661 10:48307110-48307132 TCTTCTCCCGCCGCGGAGGCAGG - Intronic
1068981858 10:63071023-63071045 TTTCCTCCCACCACAGGGGCAGG + Intergenic
1069711102 10:70489165-70489187 CATCCTCCACCCACGTAGGCTGG - Intronic
1069834879 10:71302118-71302140 ACCCATCCCACCCCGGAGGCAGG - Exonic
1073339126 10:102731795-102731817 CCTCCTCCCACCCCAAAGGGAGG - Intronic
1074406847 10:113187318-113187340 CCTCCTCCCACCCCTGCTGCTGG + Intergenic
1074614467 10:115053580-115053602 ACCCCTACCACCACTGAGGCAGG + Intergenic
1074718863 10:116247596-116247618 CCTCTTCCCACCTCTGAGGCTGG + Intronic
1075001143 10:118799003-118799025 CTTCCTCCCATCTCAGAGGCAGG - Intergenic
1075907092 10:126090993-126091015 CCTCCTCCCACCACTGATGGAGG - Intronic
1076647779 10:131965250-131965272 CTTCTTCCCAGCACGGAGGCTGG + Intergenic
1076796007 10:132798846-132798868 CCTTCTCCCGCCACAGAGGACGG - Intergenic
1076819228 10:132930509-132930531 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819296 10:132930743-132930765 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819424 10:132931183-132931205 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819480 10:132931366-132931388 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819536 10:132931571-132931593 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819599 10:132931795-132931817 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819634 10:132931912-132931934 CCTCCTCCCCACGCAGAGGCTGG + Intronic
1076819643 10:132931940-132931962 CCTCCTCCACACACAGAGGCTGG + Intronic
1076819687 10:132932112-132932134 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819721 10:132932252-132932274 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076819756 10:132932366-132932388 CCTCCTCCCCACGCAGAGGCTGG + Intronic
1076819765 10:132932394-132932416 CCTCCTCCACACACAGAGGCTGG + Intronic
1076819810 10:132932597-132932619 CCTCCTCCCCACACAGAGCCTGG + Intronic
1076865354 10:133163891-133163913 CCTCCTCCCACCTGGGATGGGGG + Intronic
1076865373 10:133163945-133163967 CCTCCTCCCACCTGGGATGGGGG + Intronic
1076865409 10:133164053-133164075 CCTCCTCCCACCTGGGATGGGGG + Intronic
1076865704 10:133165268-133165290 CCTCCTCCCCTCAGGGAAGCCGG - Intronic
1077323994 11:1955805-1955827 CCTCCTCCCAGCCCAGAGCCTGG - Intronic
1077395192 11:2317040-2317062 CTTCCTGCCCCCACGGAGCCTGG + Intronic
1077412166 11:2408692-2408714 CCTCCTCCTGCCCCGCAGGCTGG - Intronic
1078466408 11:11553540-11553562 CCTCTCCCCTCCATGGAGGCAGG - Intronic
1078500708 11:11872268-11872290 CTTCCTCACAGCATGGAGGCTGG + Intronic
1081592734 11:44436144-44436166 CCTCCTTCCACCACTGTGTCTGG - Intergenic
1081863728 11:46348228-46348250 CCTCCTGGCACCACTGAGGTGGG + Intronic
1083639565 11:64138198-64138220 CTTCCTCCTAACAAGGAGGCAGG - Intronic
1088470384 11:110183245-110183267 GCTCCTCCCTCCACGTAGACTGG - Intronic
1088625188 11:111724874-111724896 CCCCCTGCCTCCACGGTGGCGGG - Exonic
1089302193 11:117505416-117505438 GCTCCTCCCTCCCCTGAGGCTGG + Intronic
1090265656 11:125351411-125351433 CTGCCTCCCACCACGGGGGAGGG + Intronic
1090656526 11:128850077-128850099 CCGCCTCCAACCATAGAGGCTGG + Intronic
1091191693 11:133701091-133701113 CTTCCTCCCACCTCAGAGCCAGG + Intergenic
1091343514 11:134837841-134837863 CCTCCTCCAAGCACGGGAGCTGG + Intergenic
1202806980 11_KI270721v1_random:11000-11022 CCTCCTCCCAGCCCAGAGCCTGG - Intergenic
1091650053 12:2303036-2303058 CCTTCTCCCAGGACGGAGGCGGG + Intronic
1091788697 12:3258617-3258639 CCTCCTCCCACCAAGGCTGCAGG + Intronic
1092153037 12:6264205-6264227 CCTCCTGCTAGCAGGGAGGCTGG - Intergenic
1094421509 12:30276551-30276573 CCTGCTCCCACCAAGCAGACAGG - Intergenic
1095486933 12:42695142-42695164 CTTCCTCACAGCACTGAGGCTGG - Intergenic
1095506609 12:42905470-42905492 CCGCCTCCCACCCTGAAGGCTGG - Intergenic
1096007395 12:48184056-48184078 CCCTCCCCCACCCCGGAGGCCGG + Exonic
1097185814 12:57195786-57195808 CCTCCTCCCACCACCGCCGAAGG - Intronic
1098825141 12:75287396-75287418 CCTGCCCCCACCATGGAGGAAGG + Intronic
1100171118 12:91976354-91976376 CCTCAGCCCACCATGGAAGCTGG - Intergenic
1101923908 12:108955587-108955609 CCTCCTGCCACTTGGGAGGCTGG - Intronic
1102159295 12:110755652-110755674 CCTCCTCCCAGCACTGCAGCAGG - Intergenic
1102281857 12:111624770-111624792 CCTCCTCCTAAGAGGGAGGCGGG - Intergenic
1102611242 12:114114275-114114297 CAGCCTCCCACCATGGAGCCAGG + Intergenic
1103464232 12:121129033-121129055 CCTTCTCCCCCAACGGAGGTTGG + Intergenic
1104045916 12:125162758-125162780 CCCCCTCCCCCCACAGAGGTAGG - Intergenic
1104697011 12:130871695-130871717 CCGCCTCCCACCCGGGAGGCAGG + Intergenic
1104832938 12:131766793-131766815 CCTGCTCACACCACTGAGGAAGG - Intronic
1104958159 12:132475867-132475889 CCGTCGCCCACCCCGGAGGCTGG + Intergenic
1104958171 12:132475895-132475917 CCGTCGCCCACCCCGGAGGCTGG + Intergenic
1106174729 13:27320541-27320563 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1106524370 13:30527141-30527163 CCTTCTCTCTCCAGGGAGGCGGG + Intronic
1106526385 13:30544436-30544458 CCTCTTCCCTCCCCGGAGGTTGG - Intronic
1107516245 13:41132449-41132471 CCGCTTCCCACCACGGGGACTGG + Exonic
1107522174 13:41194195-41194217 CCGCCTCCCACCACGGGGACTGG + Exonic
1108040267 13:46333352-46333374 CTTCCTCACACCATGGGGGCAGG - Intergenic
1112704726 13:102054760-102054782 TCTCCTCCCACCACAGAGCAAGG + Intronic
1113521745 13:110946533-110946555 CCTCCTCCCCTCACAGCGGCCGG + Intergenic
1113706150 13:112434170-112434192 CCTCCTCCCCTCATGGCGGCCGG - Intronic
1113743144 13:112724856-112724878 CCTCATTCCACCACGGAGCCAGG + Intronic
1114654591 14:24308488-24308510 CCTCCTCCGACCAAGGAGGAAGG - Exonic
1115729962 14:36258061-36258083 CCTCCTCCCAGAACTGAGGCAGG - Intergenic
1116022206 14:39474850-39474872 CCTCCTCACACTATGGGGGCTGG - Intergenic
1118325244 14:64776022-64776044 CTTCCTCCCACCCTGGTGGCTGG + Intronic
1118372958 14:65153318-65153340 TCTCCTCCCCACCCGGAGGCAGG + Intergenic
1120650326 14:87124633-87124655 CCTCCTCCCACCTCCGACACTGG + Intergenic
1121008883 14:90508336-90508358 TCTCCTGCCATCACGGCGGCTGG - Intergenic
1121217380 14:92259169-92259191 CCTTCTCCAACCCCGGGGGCTGG + Intergenic
1121260178 14:92560121-92560143 CCTTCTCGCACCACTGAAGCTGG - Intronic
1121536660 14:94695628-94695650 CATCCTCCCACCCCACAGGCTGG - Intergenic
1121799655 14:96764031-96764053 TCTCCTTCCACCACAGGGGCTGG - Intergenic
1122473961 14:101992833-101992855 TCTCCTCCCACCTCAGTGGCTGG + Intronic
1122874684 14:104658574-104658596 CATCCGCCCACGACGGAGCCTGG + Intergenic
1202931896 14_KI270725v1_random:45435-45457 CTTCCACCCACCTGGGAGGCAGG - Intergenic
1123420621 15:20127475-20127497 CTTCCACCCACCTGGGAGGCAGG + Intergenic
1123445241 15:20326052-20326074 CTTCCACCCACCTGGGAGGCAGG - Intergenic
1123482399 15:20644265-20644287 CTTCCTCCCAGCAAGGAGACAGG + Intergenic
1123529845 15:21134004-21134026 CTTCCACCCACCTGGGAGGCAGG + Intergenic
1123724331 15:23087083-23087105 CCTGCGGCCACCACGGAGTCAGG - Intergenic
1125879956 15:43185328-43185350 CCTCCTCCCGCCACGAGGCCCGG - Exonic
1126087399 15:45023065-45023087 CCTCCTCCAGACCCGGAGGCGGG - Intergenic
1126621686 15:50646228-50646250 CCTCATCAGAACACGGAGGCAGG + Intronic
1127774072 15:62252097-62252119 CCTCCTCCCACAGTGGGGGCTGG - Intergenic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1129698841 15:77755958-77755980 CCTGCTCCCACCGAGGAGTCAGG - Intronic
1129869575 15:78931921-78931943 CCTCCTTTCTCCACAGAGGCAGG + Intronic
1130911781 15:88275914-88275936 CCTCCCTCACCCACGGAGGCTGG - Intergenic
1131180238 15:90234151-90234173 CCCCCTCCCACCCCGGAGGCGGG - Intronic
1131265880 15:90915060-90915082 ACTCCTCCCAGCAGGGAGTCAGG - Intronic
1132279620 15:100602084-100602106 CCTGCTGCCAGCACGGCGGCCGG + Intronic
1132407722 15:101554364-101554386 CTGCCTCCCACCGCTGAGGCAGG + Intergenic
1133171937 16:3987122-3987144 CCTAGTCCCCCCACTGAGGCAGG + Intronic
1133233039 16:4375253-4375275 CCTCCCTCCACCCAGGAGGCTGG - Intronic
1134410560 16:14000277-14000299 CCTCCTCCCCCGCCGGGGGCTGG - Intergenic
1136022404 16:27448620-27448642 CTGCCACCCACCACGGAGCCCGG + Exonic
1136721522 16:32322561-32322583 CTTCCACCCACCTGGGAGGCAGG + Intergenic
1136839902 16:33528849-33528871 CTTCCACCCACCTGGGAGGCAGG + Intergenic
1137399217 16:48139703-48139725 ACTCCTTCCACAAAGGAGGCTGG - Intronic
1137590857 16:49692535-49692557 CCTCCTTTCACCACGCAGGGTGG + Intronic
1137721006 16:50627467-50627489 CTTCCTCCCACCGAGGAGCCAGG + Intronic
1139402702 16:66695708-66695730 CCACCGCCCAGCACGGTGGCTGG - Intronic
1140427738 16:74875024-74875046 CCTCTTCCCACCCCGACGGCTGG + Intronic
1140484281 16:75281646-75281668 CCTCTCCCCACCCTGGAGGCTGG + Intergenic
1140819190 16:78647353-78647375 CCTCCTTCCACCTGGGAGACTGG + Intronic
1141385755 16:83621043-83621065 CCTCCTGCCAGCACTGAGACAGG + Intronic
1141447359 16:84069812-84069834 CCTCCTCCCACCACGGAGGCTGG + Intronic
1141522409 16:84589834-84589856 CCTGCCCCACCCACGGAGGCAGG + Intronic
1141678624 16:85530996-85531018 CCTGCTCCCAGCACAGAGCCAGG - Intergenic
1141694773 16:85614115-85614137 CCCTCTCCCACCTCCGAGGCTGG - Intronic
1142110159 16:88327020-88327042 CCTCCGCCCATCAGAGAGGCGGG - Intergenic
1142412442 16:89923484-89923506 CCTCCTCCCGCCCCGGGGCCCGG - Intronic
1203004910 16_KI270728v1_random:195209-195231 CTTCCACCCACCTGGGAGGCAGG - Intergenic
1203136460 16_KI270728v1_random:1731328-1731350 CTTCCACCCACCTGGGAGGCAGG - Intergenic
1203150070 16_KI270728v1_random:1829134-1829156 CTTCCACCCACCTGGGAGGCAGG + Intergenic
1143320489 17:6065499-6065521 CCTCATCCCACCACGGTCCCTGG + Intronic
1144624749 17:16838966-16838988 CCTCTTCCCAGCACGGAAGCGGG + Intergenic
1144881681 17:18433755-18433777 CCTCTTCCCAGCACGGAAGCGGG - Intergenic
1145150552 17:20510631-20510653 CCTCTTCCCAGCACGGAAGCGGG + Intergenic
1145261482 17:21357402-21357424 ACTGCTCCCACCACGGATCCTGG + Intergenic
1147578892 17:41617660-41617682 CCTCTTCCCGGCACGGAAGCGGG + Intergenic
1147793016 17:43025135-43025157 CCTCCTCCCACCCCCGCAGCCGG - Intergenic
1147979809 17:44267667-44267689 CCCTCTCCCACCTAGGAGGCAGG - Intronic
1150623420 17:66824834-66824856 CCTGCTCCCAGGACGGAGCCTGG + Intergenic
1151323239 17:73364044-73364066 CCCCCTCCAATCACGGAGCCTGG - Intronic
1151325168 17:73375352-73375374 CCACCTCCCACCCCGTTGGCTGG + Intronic
1152495561 17:80668991-80669013 GCTTCTCACACCACAGAGGCTGG + Intronic
1157580580 18:48771743-48771765 CCTCCTCCTTCCCCGGAGCCAGG + Intronic
1157622295 18:49023638-49023660 ACTCCTGTCACCACGGAGCCTGG + Intergenic
1160230467 18:77044585-77044607 CCTCCTCGCACCTGGGACGCAGG + Intronic
1161056179 19:2191643-2191665 CCTGCTCCCTCCACAGCGGCTGG + Intronic
1161399133 19:4059812-4059834 CCCTCTCCCACCTCGGAGGCAGG - Intronic
1163620619 19:18357652-18357674 CCTCCTCCACCCACTGAGCCTGG + Intronic
1164527917 19:29025496-29025518 GCTGCTCCCACCAAGGAGGGAGG - Intergenic
1164912826 19:32026404-32026426 CCTCCTCCCACCCATGTGGCTGG + Intergenic
1166079331 19:40433993-40434015 CCTCCTCCCTCCCCAGAGGCCGG - Intergenic
1166248483 19:41548278-41548300 ACTCTTCCCAGCACGGAGTCGGG + Intergenic
1166354067 19:42216965-42216987 CCTCCTCCCAGCACGGGGCCGGG + Exonic
1166912254 19:46167384-46167406 CTACCTGCCACCACGGAGCCAGG - Intergenic
1167592424 19:50411311-50411333 CCCCTTTCCACCAAGGAGGCTGG - Intronic
1167998495 19:53426048-53426070 GCTCCTCCCACGACGGAGAGAGG - Intronic
1202690159 1_KI270712v1_random:80788-80810 CTTCCACCCACCTGGGAGGCAGG + Intergenic
926221083 2:10935794-10935816 TCTTCTCCCACCCCGCAGGCGGG + Intergenic
928207210 2:29294108-29294130 CTTCCTCCCACCTCTGAGGTAGG - Intronic
928405085 2:31008659-31008681 CATCCTCCCACCACTCATGCTGG - Intronic
930102050 2:47610870-47610892 CTTCCTCACACCATGGTGGCTGG + Intergenic
931670476 2:64642769-64642791 CCTCCTCAGACCACCAAGGCTGG + Intronic
931721357 2:65069751-65069773 CCTCCTGCCACCATGGGGTCTGG + Exonic
933956254 2:87375225-87375247 CTTCCACCCACCTGGGAGGCAGG - Intergenic
934240405 2:90267249-90267271 CTTCCACCCACCTGGGAGGCAGG - Intergenic
934272785 2:91549498-91549520 CTTCCACCCACCTGGGAGGCAGG + Intergenic
934324496 2:91999829-91999851 CTTCCACCCACCTGGGAGGCAGG - Intergenic
934462873 2:94230528-94230550 CTTCCACCCACCTGGGAGGCAGG - Intergenic
934576815 2:95407136-95407158 GGTCCTCCCACCACAGAGCCAGG + Exonic
934639034 2:96015304-96015326 GGTCCTCCCACCACAGAGCCAGG + Intergenic
934657082 2:96122052-96122074 ACCCCTCCCACCACCCAGGCTGG + Intergenic
934794614 2:97090108-97090130 GGTCCTCCCACCACAGAGCCAGG - Exonic
935363605 2:102267851-102267873 AGTCCTCCCATCACGGGGGCTGG + Intergenic
936148853 2:109999420-109999442 CTTCCACCCACCTGGGAGGCAGG + Intergenic
936195827 2:110371948-110371970 CTTCCACCCACCTGGGAGGCAGG - Intergenic
936519164 2:113201101-113201123 CCTCCTCCCAACCTGGAGCCAGG + Intronic
941422688 2:165302754-165302776 CATCCTCGCTCCACGGAGACAGG + Intronic
946477836 2:220025702-220025724 CCTCCCCTCAACAGGGAGGCAGG - Intergenic
947668157 2:231919912-231919934 CCCACTCCCACCTCGGTGGCTGG - Intergenic
947752257 2:232539312-232539334 CCTACTCCCTCCAGGGAGTCAGG - Intergenic
948672296 2:239576259-239576281 CTTCCTCCCAACATGGCGGCCGG + Intergenic
948917241 2:241040522-241040544 CATCCTCCCACCCCAGAGACAGG - Intronic
1170701609 20:18708829-18708851 CCTGCTGCCACCACGGGGGCAGG - Intronic
1170948074 20:20909861-20909883 CCTCCTCCCAGTACGCAGGTGGG + Intergenic
1172447547 20:35001112-35001134 CTTCTTCCCGCCACGGAGGGCGG - Exonic
1172919582 20:38469996-38470018 CTTCCTCCCAACATGGTGGCTGG + Intergenic
1172931151 20:38587308-38587330 CCTCCTCCCTCCACTCAGACAGG - Intronic
1173403898 20:42748508-42748530 GCTGCTGCCACCAAGGAGGCAGG + Intronic
1175049995 20:56146424-56146446 CCTCCTGCCACCACTGAAGAAGG + Intergenic
1175134154 20:56810327-56810349 CTTCCTCCCAACATGGTGGCTGG - Intergenic
1175327201 20:58138006-58138028 CCACCTTCCACCCCGCAGGCCGG + Intergenic
1175846667 20:62063427-62063449 CCAGCACCCACCACGGCGGCTGG + Intronic
1176082952 20:63283115-63283137 CCTGCTCCCAACAAGGTGGCCGG - Intronic
1176593927 21:8673580-8673602 CTTCCACCCACCTGGGAGGCAGG - Intergenic
1177012861 21:15750087-15750109 CCTCTTCCCTCCCCGGATGCTGG - Intronic
1179250486 21:39667641-39667663 GCTCCTGCCACCATGGAAGCTGG - Exonic
1179783856 21:43719020-43719042 CTTCCTCCCAGCCCGGGGGCGGG + Intergenic
1179913349 21:44461432-44461454 CCACCTCCCGCCACAGAGCCTGG + Exonic
1180141506 21:45896103-45896125 TCTCCTGCCACCCGGGAGGCCGG + Intronic
1180276781 22:10650707-10650729 CTTCCACCCACCTGGGAGGCAGG - Intergenic
1180551262 22:16543768-16543790 CTTCCACCCACCTGGGAGGCAGG - Intergenic
1180584001 22:16869615-16869637 CTTCCACCCACCTGGGAGGCAGG - Intergenic
1181266216 22:21632521-21632543 CCCCCACCCACCACCGAAGCTGG - Intergenic
1181352744 22:22270160-22270182 CTTCCACCCACCTGGGAGGCAGG + Intergenic
1181905148 22:26188467-26188489 CCTTCTCCCACCATGGGAGCTGG + Intronic
1181969946 22:26682284-26682306 CTTCCTCACACCATGGTGGCTGG - Intergenic
1183423740 22:37726381-37726403 CCTGCCCCCACCCAGGAGGCTGG + Exonic
1183608893 22:38884073-38884095 CCTCCTCCCGCCAGGGCGGAAGG - Intergenic
1184071682 22:42150999-42151021 CCTCCTCCAACACAGGAGGCAGG - Intergenic
1184435965 22:44476808-44476830 CCTCCTCCCACATGGGATGCTGG - Intergenic
1185113737 22:48919462-48919484 CCTCGTCCGACCAAGGCGGCAGG + Intergenic
949573973 3:5320793-5320815 CTTCCTCCCAGCATGGTGGCTGG + Intergenic
953114320 3:39976883-39976905 CCTCCTCCCACAACGGGCCCTGG - Intronic
953713784 3:45297972-45297994 CCTCATCTCACCAAGGAGCCGGG + Intergenic
953854533 3:46490931-46490953 CCTCCTCCCAACCCTGTGGCAGG - Intergenic
953868970 3:46609747-46609769 CCTCTGCCCACCCCGGGGGCAGG - Intronic
953879282 3:46683318-46683340 CCCCCTCCCACCAGGCAGTCTGG - Exonic
954144739 3:48628922-48628944 TCTCCTGCCACCACCCAGGCAGG + Intronic
954294376 3:49665997-49666019 CCTCCTCCTCCCACAGAGGCAGG - Intronic
959591965 3:108091186-108091208 CCTGCCCGCTCCACGGAGGCCGG + Intergenic
959596123 3:108130264-108130286 CTGCCTCCCAGCACAGAGGCTGG - Intergenic
960041111 3:113150578-113150600 TGTCCTCCCAACACAGAGGCAGG + Intergenic
961243150 3:125429801-125429823 CTTCCTCACAACATGGAGGCTGG - Intergenic
961452743 3:127009691-127009713 CCCCCTCCCAGCATGGGGGCAGG - Intronic
961538504 3:127584891-127584913 CCTCCTCCCTTCCCGGTGGCTGG + Intronic
961696338 3:128707893-128707915 CATCCTCCCCCCAGGGAAGCTGG + Intergenic
962712562 3:138100162-138100184 CCTCTTCCCTCCCTGGAGGCTGG - Intronic
962987600 3:140549778-140549800 CCTCCTCCCACCTCTCTGGCTGG + Intronic
962987763 3:140551233-140551255 CCTCCTCCCACCTCTCTGGCTGG + Intronic
964613983 3:158642947-158642969 CCTCCTGCAACCAAGCAGGCTGG - Intergenic
966724744 3:183099341-183099363 CCTCCACCCACCTCGGCGGCAGG + Exonic
967084948 3:186086049-186086071 CTTACTACCACCACTGAGGCAGG + Intronic
968089020 3:195888600-195888622 ACTCCTCCCCCCACAGAGGCTGG - Exonic
968455581 4:697320-697342 TGTCTTCCCACCACGGACGCAGG + Intergenic
970162853 4:13206771-13206793 TCTCTTCCCACAACGGAGGCAGG - Intergenic
971886695 4:32458918-32458940 CTTCCTCCCATCACCCAGGCTGG + Intergenic
972245817 4:37244689-37244711 CCTCCTCCCACGGCGGGCGCGGG + Exonic
972740485 4:41882150-41882172 CCTCCCCCACCCCCGGAGGCGGG + Intergenic
973531887 4:51843472-51843494 CCTCCGCCCTCCCCGCAGGCCGG - Intronic
973650613 4:52993984-52994006 CCTCCTCCCAGCCCTGAGGCTGG + Intronic
978517998 4:109589546-109589568 CCACATCCCAGCACGGAGGATGG - Intronic
978885220 4:113760911-113760933 CCTCGCCCCAAGACGGAGGCCGG + Intronic
979674942 4:123399434-123399456 CCTCCTCCTACCACAGAGAGAGG + Intronic
981835739 4:149051113-149051135 CCTCCTCCCACTGAGGAGGAAGG - Intergenic
982361978 4:154528647-154528669 CCTCCTTCCAGCACAGAGGCAGG - Intergenic
986030541 5:3889061-3889083 CCTCCTCAGACCCCGGAGGAAGG + Intergenic
986140649 5:5026536-5026558 CCTGCTGGCACCAGGGAGGCTGG + Intergenic
986144621 5:5065768-5065790 CCTCCTCAGACCCCAGAGGCTGG - Intergenic
987675641 5:21069552-21069574 CCTCTCCCCTCCAAGGAGGCGGG - Intergenic
991948768 5:71927456-71927478 CTTCCTCACAGCATGGAGGCAGG - Intergenic
992650965 5:78859774-78859796 CCTCCTCTCACCCCGAATGCTGG + Intronic
994269513 5:97760388-97760410 CTTTCTCCCACTACTGAGGCAGG - Intergenic
995395116 5:111678915-111678937 CCTCCTCCCACAATAGAGGTGGG + Intronic
998130430 5:139648869-139648891 CCTCGACCCCCCCCGGAGGCCGG + Intronic
998266978 5:140673652-140673674 CCTCCACCCCCCTGGGAGGCGGG - Exonic
999209372 5:149874627-149874649 CCTCTTCCCTCCCCGGAGGCTGG + Intronic
999709462 5:154303553-154303575 CCTCTTCCCACCACCCAGACTGG + Intronic
1001355920 5:171022629-171022651 CCTCCTGGGACCAGGGAGGCTGG - Intronic
1001537553 5:172508755-172508777 CCTCTTCCCACCACCATGGCAGG - Intergenic
1001746556 5:174096857-174096879 CCTCCTGCCACGGCTGAGGCTGG + Intronic
1002189024 5:177469314-177469336 CCTCCTCCCTCCCCGGGGGAGGG - Intronic
1002622146 5:180495057-180495079 CCTCCTCCGACGACGGCAGCCGG - Intronic
1003305326 6:4922009-4922031 CCAGCTGCCACCACAGAGGCAGG - Intronic
1003806476 6:9730644-9730666 CCTCCTCCAACTATAGAGGCTGG + Intronic
1004396363 6:15248881-15248903 CCTCCTCCCACGCCGCAGCCCGG - Intronic
1004709441 6:18155687-18155709 CCACCTCCCACCACGGCGAGGGG - Intronic
1005574228 6:27177283-27177305 GACCCTCCCACCAAGGAGGCCGG - Intergenic
1005811536 6:29519743-29519765 GCTGCTCCCTCCAGGGAGGCGGG + Intergenic
1006103345 6:31700931-31700953 TCTCCACCTACCTCGGAGGCAGG + Exonic
1006315813 6:33290841-33290863 CCTCCCCCCACCATGGGGTCAGG - Exonic
1006891590 6:37433515-37433537 CCTCCTCCCACCCCCAACGCCGG + Intronic
1007512124 6:42381690-42381712 ACTCCTCCCTCAACGGAGGAGGG + Intronic
1008209377 6:48702231-48702253 ACTTCTTCCACCAAGGAGGCTGG - Intergenic
1008367372 6:50698137-50698159 CCTCTGCCCACCAGGAAGGCTGG - Intergenic
1010397069 6:75404759-75404781 CCTCCTTCCATCACAGAGGAAGG + Intronic
1012953493 6:105543481-105543503 CCTCCTCCCTCCCCACAGGCAGG - Intergenic
1015293306 6:131562123-131562145 CCACCTCCCTCCACTGAAGCTGG + Intergenic
1016795891 6:148116961-148116983 TCTCCTGCCACCACCGAGGAAGG + Intergenic
1017604714 6:156121760-156121782 CCTCTTCCCAGCAAGGAGGAAGG + Intergenic
1017987258 6:159455293-159455315 CCTCCCCCAACCACTGAGGCTGG + Intergenic
1018804816 6:167250229-167250251 GCTCCTCCTTCCAGGGAGGCTGG + Intergenic
1018826262 6:167409846-167409868 GCTCCTCCTTCCAAGGAGGCCGG + Intergenic
1019450297 7:1094197-1094219 CCTTCTCCCATCACCGGGGCTGG + Intronic
1019493632 7:1326268-1326290 CCTCCTCACAGCATAGAGGCCGG + Intergenic
1019637078 7:2081686-2081708 GCTCCGCCGACCACGGGGGCTGG - Intronic
1021451562 7:20787019-20787041 CCCCCTTCCACCACGGCGGCAGG - Intergenic
1023354362 7:39352377-39352399 CCGCCTCCCCTCACTGAGGCAGG - Intronic
1024232640 7:47374339-47374361 CCTCCTGCCACCTGTGAGGCTGG + Intronic
1026361979 7:69610472-69610494 CCTCCTCTCTGCAGGGAGGCTGG + Intronic
1026849352 7:73715451-73715473 CCACCTCCAACCAGGAAGGCTGG + Intronic
1027234087 7:76287490-76287512 CTTCCTCCCAGCCTGGAGGCCGG + Intergenic
1029016180 7:97317084-97317106 CCCCCTCCCATAAGGGAGGCAGG + Intergenic
1029351434 7:100015740-100015762 CGCCCTCCCACCCCAGAGGCCGG - Intronic
1032485125 7:132280202-132280224 CCCCCTCCCTCCTCAGAGGCTGG + Intronic
1032486177 7:132289125-132289147 CCTCTTCCCTCCAGAGAGGCTGG + Intronic
1032987656 7:137356656-137356678 CCTCCTCCCACCACCTGGACAGG + Intergenic
1035170762 7:157016215-157016237 CCTCCTCCCACTAGGGTGGGTGG - Intergenic
1035253660 7:157613033-157613055 CCTCCTCCGGCCACCCAGGCCGG - Intronic
1035319844 7:158021737-158021759 CCTCTCCCCACTATGGAGGCTGG - Intronic
1035330661 7:158095016-158095038 GCTCCTCCCACCACGGATGCTGG - Intronic
1035390090 7:158497837-158497859 CCTCCTCCCAGCACAGGGGACGG - Intronic
1035582475 8:748260-748282 ACCCATCCCACCACAGAGGCCGG - Intergenic
1035618650 8:1021806-1021828 CCTCCTCCCACCACTGACAGTGG - Intergenic
1039471058 8:37814121-37814143 CCTCCTCCCAGCAGGGAGCTTGG + Intronic
1039752731 8:40493014-40493036 CCTCCTCCCACCAAGTAGGCAGG - Intergenic
1039907637 8:41798197-41798219 CCTCCGCCCCCCGGGGAGGCTGG + Intronic
1040414759 8:47186444-47186466 CCTCTTCCCTCCATGGAGGTTGG - Intergenic
1044621049 8:94191011-94191033 CTTCCTCCCACCACAGAGACCGG + Intronic
1045526662 8:102946176-102946198 CTTCCTGCCACCATGGAAGCTGG - Intronic
1047980354 8:130174598-130174620 CCTCCTCCCACCTCTGGGGAGGG + Intronic
1049189524 8:141279135-141279157 CCTCCTTCCCCCACGCAGCCTGG + Intronic
1049212909 8:141394970-141394992 CCCCCTCTCTCCAGGGAGGCTGG - Intronic
1049326108 8:142022371-142022393 CCTGCACCCATCAGGGAGGCAGG + Intergenic
1049410467 8:142471754-142471776 CTTCCTCCCGCCACAGAGGCGGG - Intronic
1049510019 8:143022626-143022648 CCTCCTCCCACAGCGGAAGGAGG + Intronic
1049577997 8:143398390-143398412 CCTGCCCCCACCCCGGAGTCTGG - Intergenic
1049769787 8:144374529-144374551 CCTCCGCCCAGCCCGGAGGCGGG + Intronic
1051196205 9:14565149-14565171 CTGCCTCCCACCACTGGGGCTGG - Intergenic
1053283967 9:36838747-36838769 CCTCCTCTCTCCAGGGAGCCGGG - Exonic
1053940067 9:43239197-43239219 CTTCCACCCACCTGGGAGGCAGG - Intergenic
1056143421 9:83707141-83707163 CCTCCACCCCGCCCGGAGGCTGG + Intronic
1057294586 9:93827782-93827804 CGTCCTCCCACGGCCGAGGCCGG + Intergenic
1060555977 9:124507360-124507382 CCCCCTCACACCACGGCGGGCGG + Exonic
1061064217 9:128267385-128267407 CCTCCTCCCACAGCGGGGGCTGG - Intronic
1062028839 9:134352887-134352909 CTTCCTCACACCAAGGAAGCAGG - Intronic
1062054058 9:134461781-134461803 CATCCTCTCAACATGGAGGCTGG + Intergenic
1062308239 9:135921571-135921593 CTACCTCCCCCCACGGAGGTGGG - Intergenic
1062386612 9:136314374-136314396 CTTCCCCCCACCACGGGGGCAGG + Intergenic
1203624060 Un_KI270749v1:153810-153832 CTTCCACCCACCTGGGAGGCAGG - Intergenic
1185497758 X:570660-570682 CTTGCTCCCATCACAGAGGCTGG + Intergenic
1185579287 X:1198142-1198164 CTCCCTCCCACCTCGAAGGCAGG + Intronic
1185579308 X:1198202-1198224 CTCCCTCCCACCTCGAAGGCAGG + Intronic
1185579353 X:1198326-1198348 CTCCCTCCCACCTCGAAGGCAGG + Intronic
1185579373 X:1198386-1198408 CTCCCTCCCACCTCGAAGGCAGG + Intronic
1185579394 X:1198446-1198468 CTCCCTCCCACCTCGAAGGCAGG + Intronic
1185600693 X:1336934-1336956 CCTCATCCCACCCTGGAGGGGGG - Intronic
1186660602 X:11664858-11664880 CCTCCTCCCTCCCTGGACGCTGG + Exonic
1187095900 X:16148421-16148443 CCTCCTCCTACCAGGGAAGGGGG - Intronic
1187609002 X:20920015-20920037 CCTCCTCCCCGGACAGAGGCTGG + Intergenic
1189167263 X:38872434-38872456 CCTCCTCCCACCACCCAGAGTGG - Intergenic
1190435629 X:50421821-50421843 CCATATCCCACCACTGAGGCTGG + Intronic
1190708273 X:53048485-53048507 CCTCCGCCCGCCCCTGAGGCAGG + Intergenic
1191797422 X:65035312-65035334 CCTCCTGGGGCCACGGAGGCCGG - Intergenic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1195115037 X:101688793-101688815 TCTCCTCTCACCACTGAGGTTGG - Intergenic
1196465494 X:115968491-115968513 CCTCCTCCAGCCACGTAGGTGGG + Intergenic
1197661833 X:129181755-129181777 CCTACTCCCATCGCCGAGGCTGG - Intergenic
1197768476 X:130074147-130074169 TCTCCTCCCACCATGGAACCCGG - Intronic
1197869518 X:131051693-131051715 CCTCTTCACATCACGGGGGCTGG - Intergenic
1197873969 X:131084754-131084776 CCTCCCCCCACCAGGTAGTCAGG - Intronic