ID: 1141448529

View in Genome Browser
Species Human (GRCh38)
Location 16:84080506-84080528
Sequence GCAGAGGAGACCTGAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 366}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141448529_1141448533 17 Left 1141448529 16:84080506-84080528 CCAGCAGCTCAGGTCTCCTCTGC 0: 1
1: 0
2: 4
3: 44
4: 366
Right 1141448533 16:84080546-84080568 CACCCGCAGCTGCCACCCTCAGG 0: 1
1: 1
2: 6
3: 31
4: 240
1141448529_1141448531 -10 Left 1141448529 16:84080506-84080528 CCAGCAGCTCAGGTCTCCTCTGC 0: 1
1: 0
2: 4
3: 44
4: 366
Right 1141448531 16:84080519-84080541 TCTCCTCTGCAGGACACTGCTGG 0: 1
1: 0
2: 4
3: 38
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141448529 Original CRISPR GCAGAGGAGACCTGAGCTGC TGG (reversed) Intronic