ID: 1141450195

View in Genome Browser
Species Human (GRCh38)
Location 16:84094257-84094279
Sequence CGGGACACAAAAATGGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 222}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141450190_1141450195 -7 Left 1141450190 16:84094241-84094263 CCACACACCCAAGGAGCGGGACA 0: 1
1: 0
2: 0
3: 5
4: 150
Right 1141450195 16:84094257-84094279 CGGGACACAAAAATGGGAAAAGG 0: 1
1: 0
2: 0
3: 22
4: 222
1141450186_1141450195 12 Left 1141450186 16:84094222-84094244 CCTGCAAAACACTCACAAACCAC 0: 1
1: 0
2: 0
3: 15
4: 208
Right 1141450195 16:84094257-84094279 CGGGACACAAAAATGGGAAAAGG 0: 1
1: 0
2: 0
3: 22
4: 222
1141450183_1141450195 28 Left 1141450183 16:84094206-84094228 CCACCTTCTCGGAGGCCCTGCAA 0: 1
1: 0
2: 2
3: 16
4: 162
Right 1141450195 16:84094257-84094279 CGGGACACAAAAATGGGAAAAGG 0: 1
1: 0
2: 0
3: 22
4: 222
1141450182_1141450195 29 Left 1141450182 16:84094205-84094227 CCCACCTTCTCGGAGGCCCTGCA 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1141450195 16:84094257-84094279 CGGGACACAAAAATGGGAAAAGG 0: 1
1: 0
2: 0
3: 22
4: 222
1141450181_1141450195 30 Left 1141450181 16:84094204-84094226 CCCCACCTTCTCGGAGGCCCTGC 0: 1
1: 0
2: 0
3: 18
4: 265
Right 1141450195 16:84094257-84094279 CGGGACACAAAAATGGGAAAAGG 0: 1
1: 0
2: 0
3: 22
4: 222
1141450185_1141450195 13 Left 1141450185 16:84094221-84094243 CCCTGCAAAACACTCACAAACCA No data
Right 1141450195 16:84094257-84094279 CGGGACACAAAAATGGGAAAAGG 0: 1
1: 0
2: 0
3: 22
4: 222
1141450184_1141450195 25 Left 1141450184 16:84094209-84094231 CCTTCTCGGAGGCCCTGCAAAAC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1141450195 16:84094257-84094279 CGGGACACAAAAATGGGAAAAGG 0: 1
1: 0
2: 0
3: 22
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141450195 Original CRISPR CGGGACACAAAAATGGGAAA AGG Intronic
905984087 1:42261036-42261058 AGGGAAACAAAATTGAGAAAAGG + Intronic
906226015 1:44122038-44122060 TGGGACAAAAAAATGAAAAAAGG - Intronic
906777133 1:48539971-48539993 AAGGTCACAAAACTGGGAAAAGG + Intronic
907640945 1:56189808-56189830 AGTGATACAAACATGGGAAATGG + Intergenic
910215630 1:84841200-84841222 TGTATCACAAAAATGGGAAATGG - Intronic
910985543 1:93001749-93001771 TGGGAAACAAAAATGGAAGAAGG - Intergenic
911123566 1:94319699-94319721 GGGGACACAAAACTGGGGAGGGG - Intergenic
911285265 1:95983737-95983759 GGGGACACTAAAATGAAAAAAGG - Intergenic
912096657 1:106152872-106152894 AGGGACAAAAAGATGGAAAATGG + Intergenic
914435600 1:147656610-147656632 AGGGACACAAAACTGGTAAATGG - Intronic
916090445 1:161304864-161304886 CAGGAAAAACAAATGGGAAATGG - Exonic
916604298 1:166325885-166325907 CAGGACACAAAAATGAGGATGGG - Intergenic
916769522 1:167894560-167894582 AGGGAGACAGAAATGGCAAAGGG + Intronic
918605680 1:186422928-186422950 CGGGACACAAAGATTGAAAAAGG + Intergenic
919270289 1:195333022-195333044 TGGGACACAGATATGGGCAAAGG + Intergenic
921841031 1:219828750-219828772 CTGGACACAGGAATGGGCAAAGG - Intronic
922218038 1:223536517-223536539 AGGGACAGCAAAATGGGAAAAGG - Intergenic
922808849 1:228404790-228404812 CTGGACACAGAAATGGGATTGGG - Intronic
923050600 1:230388877-230388899 CAGGCCACAGAAATGGGGAAAGG + Intronic
923130612 1:231071594-231071616 CAGGACAGGAAAATGGGAACAGG + Intergenic
924592932 1:245420836-245420858 CAGAACACAAATATGGGGAAGGG + Intronic
1063330310 10:5151891-5151913 TGGGCTATAAAAATGGGAAAAGG + Intergenic
1063348664 10:5335252-5335274 CGGGAGATCAAGATGGGAAATGG + Intergenic
1063835908 10:10011718-10011740 AGGGACAGAAAAATGGAAAGTGG + Intergenic
1064465996 10:15582519-15582541 CGGGACACATATTTGGTAAATGG + Intronic
1065139167 10:22703828-22703850 CGGGACTCAAAAATTGGATGTGG + Intronic
1065829911 10:29605508-29605530 CAGCTCACAAAAAAGGGAAAAGG - Intronic
1066682766 10:37950388-37950410 CAGGATACAAAAATGGGTAGTGG + Exonic
1069265654 10:66454119-66454141 GAGCACACAAAAGTGGGAAAAGG + Intronic
1072088652 10:92105426-92105448 ATGAACACAAAAATGGGAAATGG - Intronic
1073049960 10:100660998-100661020 GAGGACACTAATATGGGAAAGGG + Intergenic
1073440003 10:103546927-103546949 CAGGACACAGAGGTGGGAAATGG - Intronic
1073844820 10:107543435-107543457 GGGGAGAAAAAAATTGGAAAGGG - Intergenic
1075920417 10:126207246-126207268 CAGGACACAGAAAAGGGAAAGGG + Intronic
1078729919 11:13964501-13964523 GGGGACACAAACCCGGGAAAGGG - Intronic
1081453329 11:43194673-43194695 AAGGGTACAAAAATGGGAAATGG + Intergenic
1083181068 11:60985871-60985893 TCGGACAGAAAAATTGGAAAAGG + Intronic
1084353543 11:68621562-68621584 CGTGATTCAAAAATGGGCAAAGG + Intergenic
1085585903 11:77705694-77705716 CTGGACCCAAAGAAGGGAAAAGG - Intronic
1094541988 12:31370365-31370387 CTGAACACCAAAACGGGAAAGGG + Intergenic
1095683468 12:45005330-45005352 AGGGAGACCAAAAAGGGAAATGG - Intergenic
1095825756 12:46529872-46529894 AAAGACAAAAAAATGGGAAATGG - Intergenic
1097015345 12:55982180-55982202 CGAGACAAAAAAAAGGGAGATGG - Intronic
1097746516 12:63309966-63309988 CGAGACCCAAAAAGGGGTAAAGG - Intergenic
1097965074 12:65570509-65570531 GGAGACAGAAAAATGGGCAAAGG + Intergenic
1099500868 12:83413036-83413058 CGGGACAAAAGAAGGGGAATAGG - Intergenic
1100593379 12:96050532-96050554 GGGGACTCCAAAAGGGGAAAGGG + Intergenic
1101541191 12:105666990-105667012 AGGGACACAAAAATGACACAGGG + Intergenic
1106234343 13:27849003-27849025 GGGAACTCAAAAATTGGAAATGG + Intergenic
1106849246 13:33771211-33771233 CGGGACACACAAATGAGAATGGG + Intergenic
1107451706 13:40515908-40515930 CAGGAGACATGAATGGGAAATGG - Intergenic
1107715302 13:43193808-43193830 CTGGACACAGATCTGGGAAATGG - Intergenic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1110556088 13:76861013-76861035 CTGGAGGCAAAAATGGAAAATGG + Intergenic
1111562220 13:89966616-89966638 TGAGACACCAAGATGGGAAAGGG + Intergenic
1112276242 13:98023340-98023362 TGGGAGAAAAAAATGGGAATTGG + Exonic
1112785955 13:102952147-102952169 CTGGTCACAAAAATGCGAAGAGG + Intergenic
1113777360 13:112955395-112955417 CTGAACACAAAAATGGGCCATGG - Intronic
1114724912 14:24925817-24925839 CCCTACACAAAAATGGGAAAGGG + Intronic
1115630891 14:35244101-35244123 TGGGACACAGAAAGTGGAAATGG - Intronic
1116002993 14:39264101-39264123 AGGGACTCAAAAATGAGGAAGGG - Intronic
1116305111 14:43243703-43243725 GGGGACCCAGAAATGGGGAAGGG - Intergenic
1117036560 14:51735659-51735681 AGGCACACAAAAAGGGAAAAAGG + Intergenic
1117667371 14:58070551-58070573 CTGGACATAAAAATGGCAAGGGG + Intronic
1118721156 14:68594780-68594802 AGGGCCACAAGAATGAGAAAGGG + Exonic
1120801155 14:88690163-88690185 GGGGAGACAGTAATGGGAAATGG + Intronic
1122142513 14:99671454-99671476 AGGGACACAAAAGAGGGACAAGG - Intronic
1122172023 14:99884549-99884571 CGGAATAGAAAAATGGTAAAGGG + Intronic
1122184803 14:99983540-99983562 CAGGACAAATACATGGGAAAAGG - Intronic
1126240494 15:46437136-46437158 AGAGACAGAGAAATGGGAAAGGG + Intergenic
1127674120 15:61224586-61224608 CTAAACACAAAAATGGGAGAAGG + Intronic
1129061274 15:72862220-72862242 CGGGTCACACAAACAGGAAATGG - Intergenic
1129576808 15:76757928-76757950 CCTGACTCAAAAATGGGCAAAGG - Intronic
1130381809 15:83378485-83378507 AGTCACAGAAAAATGGGAAATGG - Intergenic
1130913408 15:88286356-88286378 AGTGACACAAAAATAGGCAATGG + Intergenic
1133818497 16:9215960-9215982 AGGGCCACACAACTGGGAAATGG - Intergenic
1134507981 16:14823508-14823530 AGGGACACACAAATGGGAAGTGG + Intronic
1134695683 16:16222271-16222293 AGGGACACACAAATGGGAAGTGG + Intronic
1134976145 16:18572415-18572437 AGGGACACACAAATGGGAAGTGG - Intergenic
1135859225 16:26039989-26040011 CTAGACACCTAAATGGGAAATGG + Intronic
1135990154 16:27213780-27213802 GGGAACGCTAAAATGGGAAAAGG - Intronic
1139034259 16:62924115-62924137 AAGGACATAAAATTGGGAAAAGG - Intergenic
1141450195 16:84094257-84094279 CGGGACACAAAAATGGGAAAAGG + Intronic
1143476761 17:7207593-7207615 CTGGACACAGAAAATGGAAATGG + Intronic
1144289333 17:13810541-13810563 TGGGAAAAAAAAATGGCAAAAGG + Intergenic
1145936161 17:28716062-28716084 CTGGACACAAGAGTGGGCAAGGG + Intronic
1151511472 17:74563155-74563177 GGGGACACCAACATGGGAGAAGG - Intergenic
1152624966 17:81383936-81383958 AGGGACACAGAAATCGGAAGGGG + Intergenic
1154336394 18:13469051-13469073 CCAAACACAAAAATGGGCAAAGG + Intronic
1155338079 18:24785403-24785425 AGGGAAACCAAAATGGGCAATGG - Intergenic
1156398169 18:36717798-36717820 TGGGAGAGAAAAATGAGAAAGGG - Intronic
1157942419 18:51943594-51943616 AAGTACACAAAAATGGAAAATGG - Intergenic
1157959088 18:52132279-52132301 CGTAACACCACAATGGGAAAAGG + Intergenic
1158448656 18:57543466-57543488 CGGGACACAAAACGGTGAAGTGG + Intergenic
1159795627 18:72839729-72839751 AGGAACAGAAAAATGGGAAGAGG + Intronic
1163709305 19:18836522-18836544 CTGGACAGAAAGGTGGGAAAGGG + Intronic
1165154142 19:33777297-33777319 CGGGATCCAGAAATGGGCAAAGG + Intergenic
1165780958 19:38434069-38434091 GGGGACTCCAGAATGGGAAAGGG + Intronic
1166563553 19:43749303-43749325 TGGGAGAAAAAAATGGGAAGAGG + Intronic
1167703708 19:51065914-51065936 CAGGACCCAAAAAAGGGTAAGGG + Intergenic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
925517130 2:4695402-4695424 CAGGAAACAAAAGTGGGAGAAGG + Intergenic
930172202 2:48263372-48263394 AGGGACAAAAACATGGGCAAAGG + Intergenic
931921550 2:67021996-67022018 CAGGACATCAAAATAGGAAAAGG + Intergenic
935619469 2:105116481-105116503 TGGGACACACACATCGGAAATGG - Intergenic
940006426 2:149012783-149012805 CTAGACAGGAAAATGGGAAATGG + Intronic
940255959 2:151729517-151729539 AGGGCCACAAAGATGGCAAAAGG - Intronic
941174885 2:162184541-162184563 CGGGACAAACAGATGGGAAGAGG + Intronic
941719332 2:168796775-168796797 AGGAACTCTAAAATGGGAAATGG - Intronic
941750086 2:169126260-169126282 CTGTACATAGAAATGGGAAAAGG - Intergenic
941787601 2:169515354-169515376 CTGCACACTAAAATGGGACATGG + Intronic
942210264 2:173663153-173663175 CAGGAGATAAAAATGGGACAGGG - Intergenic
943671543 2:190666764-190666786 TGGGCCACAAAAAGAGGAAATGG + Intronic
948203116 2:236144005-236144027 CGGAACACAGAATTGGGAAGAGG - Intergenic
948592088 2:239057017-239057039 CGGGACCCTAAAATGGAGAAAGG + Intronic
1169534455 20:6523118-6523140 CGAGACACAAATATATGAAATGG + Intergenic
1170192048 20:13654163-13654185 CAGGGCACAGAAATGGTAAAAGG - Intergenic
1171111752 20:22490726-22490748 CCCCACGCAAAAATGGGAAAGGG - Intergenic
1171164509 20:22958157-22958179 AGGGGCACAGAAATGGTAAAGGG + Intergenic
1171191907 20:23164797-23164819 CTGGACACAGAAGTGGAAAATGG - Intergenic
1171991019 20:31696433-31696455 AGGGACACAAAGCTGGAAAAGGG + Intronic
1172572626 20:35982396-35982418 CGGGAAAGGAAAATGGGAGAAGG - Intronic
1175524483 20:59624076-59624098 GGGGACATAAGAGTGGGAAATGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176936074 21:14868526-14868548 AGTGACACTAAAATGAGAAAAGG + Intergenic
1177101877 21:16908140-16908162 CAGGACATAAAAATGGTAATAGG + Intergenic
1178102688 21:29286806-29286828 AGGTGCACAAAAATGGTAAAAGG + Intronic
1179368694 21:40783610-40783632 CGTGACACATAAAGAGGAAAAGG + Intronic
1180609066 22:17084333-17084355 GGGGACAATAAAATGGGATATGG + Intergenic
1182916648 22:34039285-34039307 ATTGACACAAAGATGGGAAAGGG - Intergenic
1182990116 22:34759579-34759601 CAGGACACAGAACTGGGAGAAGG - Intergenic
951155510 3:19348568-19348590 AGGGACAGGAAAATAGGAAAAGG - Intronic
955634133 3:61007745-61007767 TGGGACACCAAACTGGTAAAAGG - Intronic
958758550 3:98278993-98279015 AGGGACAGAAAAAGTGGAAAGGG - Intergenic
959651615 3:108756340-108756362 AGGGAAACAAGAATGGGCAAGGG + Intronic
963932259 3:151015573-151015595 CGGGACATCAAACTGGGAAAGGG - Intergenic
964137517 3:153361515-153361537 GGGGACACAATAATAGGTAATGG + Intergenic
965006841 3:163038133-163038155 AGGAAAACAAAAATGGAAAAAGG - Intergenic
965820997 3:172684424-172684446 CTGCAAACAAAAATTGGAAATGG + Intronic
967359995 3:188619425-188619447 AGGGGCAGAAAAATGGGAACTGG + Intronic
967741784 3:193010860-193010882 TGGGAAAAAAAAATGAGAAATGG - Intergenic
969680132 4:8638582-8638604 TGGGACTAAAAAATGGGAAGAGG + Intergenic
970797237 4:19927653-19927675 CTGAACACAAAAATGTGAAGTGG - Intergenic
970887629 4:21004851-21004873 CGGGATTCAAAAATGCTAAAGGG + Intronic
971170015 4:24224303-24224325 AGGTACTCAAAAATGGGAAAGGG + Intergenic
971450698 4:26798864-26798886 GGGGATTCAAAAATGGGAGAGGG + Intergenic
972348483 4:38213378-38213400 CGGGAAATACAAATTGGAAAGGG + Intergenic
973662039 4:53118127-53118149 TGAGACACAAAAATGTGAGATGG + Intronic
973991230 4:56409506-56409528 TGAGACACAGACATGGGAAAGGG - Intronic
975224034 4:71848899-71848921 AGAGCCACAAAAATGGGAGATGG - Intergenic
975337949 4:73203227-73203249 AGGGGCAGAAAACTGGGAAAGGG - Intronic
976019948 4:80610433-80610455 TGGGAGACAAAAATGAGAAGTGG - Intronic
978109966 4:104951580-104951602 TAGGAGACAAAAATGGGACAAGG + Intergenic
978734934 4:112075243-112075265 CTGGACTCAAGAGTGGGAAAGGG - Intergenic
979139828 4:117157869-117157891 ATGGAGACAAAAATGGGAGATGG - Intergenic
979428707 4:120600190-120600212 CGCTACTCAAAAATGGGCAAAGG + Intergenic
981437715 4:144746312-144746334 CAGCACCTAAAAATGGGAAATGG - Intergenic
983346414 4:166531656-166531678 CGTGACAGAAAAATGGGCTAAGG - Intergenic
984093107 4:175399849-175399871 TGGAATACAAAATTGGGAAAGGG + Intergenic
988322231 5:29713355-29713377 CAGGAGACAAAAAAGGGAACAGG + Intergenic
988725349 5:33920974-33920996 TGGGAGAGAAAAATGGGAAAAGG - Intergenic
988804382 5:34726786-34726808 CGGAACACAAAAAAGAGCAAAGG - Intronic
989269469 5:39515148-39515170 AGAGACACAAAATTGGTAAATGG + Intergenic
989310378 5:40010097-40010119 CAGGAGACAAAAATGGTAATTGG + Intergenic
990326259 5:54678544-54678566 CGGGACAGAAAATGGGGAGAAGG + Intergenic
990842313 5:60096160-60096182 CAGGACACAAGCATGGGCAAAGG - Intronic
991083704 5:62628309-62628331 CAGTACATAAAAAGGGGAAAAGG + Intronic
992368549 5:76118457-76118479 CTCAATACAAAAATGGGAAAAGG + Intronic
992752612 5:79874970-79874992 CAGGAAAGAAAAAAGGGAAAGGG + Intergenic
994068201 5:95567366-95567388 ATGTACACAGAAATGGGAAAAGG + Intronic
994551852 5:101244123-101244145 AGGAACACAAAATGGGGAAAAGG + Intergenic
994813488 5:104554405-104554427 CAAGACACACAAATGGCAAACGG + Intergenic
996872664 5:128208892-128208914 TGGGATACAAGAAAGGGAAAGGG - Intergenic
998677591 5:144426966-144426988 GGGGACAGAAAAATGGCCAATGG - Intronic
1000837984 5:166179581-166179603 AGAGACACAAAGATGGAAAATGG + Intergenic
1002219234 5:177665960-177665982 CGCAACAGAAAAATGGGCAAAGG + Intergenic
1003408923 6:5846437-5846459 AGGGGCATGAAAATGGGAAAGGG - Intergenic
1004306747 6:14508201-14508223 TGGGACATAAAAATTTGAAAGGG - Intergenic
1004484091 6:16049283-16049305 AGGGAAAAAAAAATGTGAAAGGG - Intergenic
1005650320 6:27879539-27879561 GGGAACACAAAGATGGGAATAGG + Intergenic
1005902859 6:30233671-30233693 CGAGACAGAAAAAAGGAAAAAGG - Intergenic
1006071731 6:31502385-31502407 GAGGACACAAAAAATGGAAAAGG - Intronic
1007141393 6:39578255-39578277 ATGGACACAAAAATGGGTAATGG + Intronic
1007899653 6:45399290-45399312 AGGAAGACAAAAAAGGGAAAGGG - Intronic
1008186593 6:48400021-48400043 AGGGAGACAAAAATGGGAGCTGG - Intergenic
1009344120 6:62592450-62592472 CAGGACACAAAAATCCAAAAAGG - Intergenic
1011256377 6:85425850-85425872 GGTAACACAAAAATGGAAAATGG + Intergenic
1011702689 6:89970265-89970287 CGGGGCACAGAACTGGGAACAGG - Intronic
1012162307 6:95901174-95901196 CAAGACACAAAAATGTGATAAGG - Intergenic
1014244174 6:119049758-119049780 CAGGACACAGGAATGGGCAAAGG + Intronic
1014464259 6:121736582-121736604 CAGGACACAGACATGGGCAAAGG - Intergenic
1014969809 6:127800711-127800733 GGAGGCAGAAAAATGGGAAAGGG + Intronic
1016921168 6:149295464-149295486 GGGGACAGAGACATGGGAAAAGG - Intronic
1017266478 6:152451879-152451901 AGGGACACATACAGGGGAAAGGG - Intronic
1018590721 6:165418560-165418582 AGGCACAGAAAAATGGGTAACGG + Intronic
1019083162 6:169450098-169450120 CTAGACTCAAAAGTGGGAAAGGG - Intergenic
1019201491 6:170319849-170319871 TTGGAGAAAAAAATGGGAAAAGG + Intronic
1019331289 7:462058-462080 CTGGACCCACACATGGGAAAGGG + Intergenic
1021335101 7:19390703-19390725 GGGGACAGAAAAATAGCAAAGGG - Intergenic
1022414748 7:30168270-30168292 AGGGAGTCAAAAAAGGGAAAGGG + Intergenic
1023869608 7:44255980-44256002 CTGGACAGAAAAATGGGGAAAGG - Intronic
1024725316 7:52187873-52187895 TGTCACTCAAAAATGGGAAAAGG - Intergenic
1024874945 7:54010953-54010975 CTGGACAAAAAAATGGGCAATGG - Intergenic
1026024716 7:66735184-66735206 CACTACACAACAATGGGAAATGG - Intronic
1026085757 7:67261703-67261725 CTGGACAGAAAAGAGGGAAATGG - Intergenic
1026893096 7:73994082-73994104 CACTACACAACAATGGGAAATGG - Intergenic
1028225293 7:88244031-88244053 CAGGAAACAAAAATGGGATGAGG + Intergenic
1029860568 7:103567350-103567372 TGGGACAAGAAAAGGGGAAAAGG - Intronic
1030217791 7:107063774-107063796 TGGGAGAAACAAATGGGAAAAGG - Intronic
1032019280 7:128397888-128397910 GGGGACTCCAAAATGGGAGAGGG - Intronic
1032927210 7:136620755-136620777 CAGGACACAGAAACAGGAAAGGG + Intergenic
1036450783 8:8865407-8865429 CTGGATACAAAAATCAGAAATGG + Intronic
1036727617 8:11233468-11233490 CGGGACAGGAGAAGGGGAAAAGG - Intergenic
1038086795 8:24206906-24206928 GGGGAAACAAACATGGAAAAGGG - Intergenic
1042276671 8:67012285-67012307 CAGGACACATAAATGGGACATGG - Intronic
1042781405 8:72494980-72495002 TGGGACACAATAGTGAGAAAGGG - Intergenic
1043045347 8:75315880-75315902 TTGGACACAAGAATGGGAAAAGG + Intergenic
1043908482 8:85833647-85833669 AGGGGCAAAAAAATGGGAGAGGG - Intergenic
1044493732 8:92851163-92851185 GGGGACTCCAAAAGGGGAAAGGG - Intergenic
1046978856 8:120314173-120314195 TTGGACACAAAAATGGCTAAGGG - Intronic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1051532248 9:18117591-18117613 TGGGAAACAACAATGGGAAGAGG - Intergenic
1052048958 9:23824193-23824215 CGGTACTTGAAAATGGGAAACGG + Intronic
1052334002 9:27301399-27301421 AAAGACACAGAAATGGGAAAGGG - Intergenic
1056267262 9:84910433-84910455 AGGGACACAGACATGTGAAAAGG - Intronic
1057126873 9:92623496-92623518 CTGGACACAAAATTGACAAAGGG + Intronic
1059108679 9:111534105-111534127 CTTGAGACAAAAATGGGAAAAGG - Intronic
1059939310 9:119342428-119342450 AGAGACACAAAGAAGGGAAATGG + Intronic
1060507983 9:124212728-124212750 CAGGACACACACATGGGAGAAGG - Intergenic
1060677341 9:125527428-125527450 AGGGACTCAAGAATGGGACAGGG - Intronic
1061216139 9:129223056-129223078 GGGGACACACACCTGGGAAACGG - Intergenic
1062182281 9:135196820-135196842 TGGGAAAGAAAAATGGGAAGGGG - Intergenic
1062241776 9:135544809-135544831 CAGGCAACAAAAATGGGGAACGG + Intergenic
1185491207 X:518441-518463 GGAGACAGAAAAATGGAAAAGGG - Intergenic
1187428462 X:19200374-19200396 AGGGACAGAAAAATATGAAATGG + Intergenic
1187819015 X:23265344-23265366 TGGAACAGAAAAATGGGCAAAGG - Intergenic
1189535178 X:41927890-41927912 AGGCACACAGAAATGGGAAAGGG - Intergenic
1190317071 X:49157844-49157866 CGGAACTCAAAAATTGGAGAGGG + Intergenic
1190659199 X:52639169-52639191 AGGGAAAGGAAAATGGGAAAAGG + Intergenic
1191204928 X:57823541-57823563 GGGGACTCCAAAATGGGGAAGGG + Intergenic
1192409411 X:70919809-70919831 AAGAACACAAAAAGGGGAAAGGG - Intergenic
1193535675 X:82712455-82712477 CGAGACACTAAAAAGAGAAAGGG - Intergenic
1193866788 X:86741750-86741772 AAGGAGACAAAAAGGGGAAAGGG + Intronic
1194525606 X:94973305-94973327 CTGGACACAGAAATGGGCAAAGG - Intergenic
1194776050 X:97966215-97966237 GGGGACTCAAAAATGGGAGAGGG - Intergenic