ID: 1141452051

View in Genome Browser
Species Human (GRCh38)
Location 16:84111009-84111031
Sequence ATTTTTCAGCCTACTGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 2, 2: 3, 3: 29, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141452051_1141452058 20 Left 1141452051 16:84111009-84111031 CCTCCTGCAGTAGGCTGAAAAAT 0: 1
1: 2
2: 3
3: 29
4: 163
Right 1141452058 16:84111052-84111074 CATCCTCATTCCTAGAACCTGGG 0: 1
1: 0
2: 5
3: 28
4: 254
1141452051_1141452057 19 Left 1141452051 16:84111009-84111031 CCTCCTGCAGTAGGCTGAAAAAT 0: 1
1: 2
2: 3
3: 29
4: 163
Right 1141452057 16:84111051-84111073 ACATCCTCATTCCTAGAACCTGG 0: 1
1: 0
2: 6
3: 35
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141452051 Original CRISPR ATTTTTCAGCCTACTGCAGG AGG (reversed) Intronic
902814245 1:18907162-18907184 TTTTTTAAGCCTACTGCAGTGGG - Exonic
903426018 1:23254863-23254885 ATTTTTCAACCTACTACAGAGGG - Intergenic
903489853 1:23719999-23720021 ATTATTCTGCCTAATGCAGGTGG + Intergenic
905189151 1:36219855-36219877 TTTTTTCAGGCTAATGCAGCTGG + Intergenic
905219410 1:36434052-36434074 CCTTTTCAGCCTAGTGCGGGTGG + Intronic
910963556 1:92785591-92785613 TTTATGCAGACTACTGCAGGGGG + Intronic
911617574 1:100031640-100031662 TTTTTTCAGCCAAATGCAGATGG - Intergenic
912148913 1:106831940-106831962 ATTTTTCAGCCTATTACATTTGG + Intergenic
914366936 1:146987471-146987493 ATTTACTAACCTACTGCAGGTGG + Intronic
914367472 1:146992232-146992254 ATTTACTAACCTACTGCAGGTGG + Intronic
914453935 1:147817773-147817795 ATTTTTCATTTTACTGCAAGGGG + Intergenic
914485512 1:148105973-148105995 ATTTACTAACCTACTGCAGGTGG - Intronic
918872235 1:189990287-189990309 ATCTTTCTGACTTCTGCAGGAGG + Intergenic
919004309 1:191875111-191875133 ATTTTTCAGCCTAATACATAAGG + Intergenic
920329360 1:205194517-205194539 ATTTTTAAAACTACTGAAGGAGG - Intronic
921040336 1:211425126-211425148 TTTAATCAGCCTACTGCAGATGG - Intergenic
921393518 1:214642916-214642938 ATTTTGCAGCAGTCTGCAGGAGG + Exonic
922429421 1:225534208-225534230 ATTTTTCTGCCTCCTCCTGGGGG - Intronic
923790949 1:237110765-237110787 ATGTTTCAGTCCACAGCAGGAGG - Intronic
924324130 1:242878272-242878294 ATTTCTCACCCTTCTGGAGGTGG - Intergenic
1063271584 10:4515305-4515327 ATTTTTCCCCTTACTTCAGGCGG + Intergenic
1063840374 10:10065017-10065039 ACTTTTTAGCCAACTGCAAGCGG - Intergenic
1068105502 10:52609968-52609990 AATTGTCTGCATACTGCAGGGGG - Intergenic
1068690429 10:59908107-59908129 ATTTTTTAGCTTAGTGCTGGAGG + Intergenic
1070716827 10:78728623-78728645 ATTTCTCAGCCTCATGTAGGTGG - Intergenic
1071427165 10:85570842-85570864 ATTTTTCAGCAAACTTTAGGAGG - Intergenic
1072708564 10:97700195-97700217 ATATTTCAGACTATTGCATGGGG - Intergenic
1076067304 10:127458878-127458900 TTTCTGCAGCCCACTGCAGGGGG - Intergenic
1080415662 11:32067786-32067808 ATTATTTAGCCTACTACAGAGGG - Intronic
1085772929 11:79340807-79340829 ATTTTTCAGCCTACCACACCAGG - Intronic
1086154452 11:83650132-83650154 ATCATTCAGCCTACTGCACACGG - Intronic
1086364005 11:86089612-86089634 ATTTTTAATCCTACTTCTGGAGG - Intergenic
1086994642 11:93342171-93342193 ATTTTTCAGCCTACTTCATATGG + Intronic
1088617809 11:111649116-111649138 ATATTTCAGCATACTGTAGCTGG + Intronic
1091200836 11:133779561-133779583 ATTTTTCTGCCTTCTGAATGAGG - Intergenic
1091396445 12:156552-156574 ACTGTTCAGCCTACAGCAGAAGG + Intronic
1094463929 12:30730184-30730206 ATTTTTCAGCCTTTTGCATAGGG - Intronic
1095729713 12:45493321-45493343 TTTTTTCAGCCTACCACAGATGG + Intergenic
1096617211 12:52840188-52840210 ACTCTTCAACCTACTGCAGGAGG - Intronic
1101568994 12:105935918-105935940 ATTATACAGCCTACCACAGGAGG + Intergenic
1102901717 12:116643904-116643926 ATTTTTCAGCCTACTGCAAGAGG - Intergenic
1102937003 12:116906044-116906066 ATTATTCAGCCTACAGCAGCTGG - Intergenic
1104006512 12:124896527-124896549 ATTGTTCAGCCTACCACAGAGGG + Intergenic
1106356385 13:28987386-28987408 CTGTTTCAGCCTACTAGAGGGGG + Intronic
1108826981 13:54424105-54424127 ATTTTTCAGGTTACTTCAGGTGG + Intergenic
1109740657 13:66550457-66550479 ATTTTTCAGCCTGCTTTGGGAGG + Intronic
1111424987 13:88068928-88068950 AGTTTTCTGCCTGGTGCAGGTGG - Intergenic
1111657367 13:91170607-91170629 ATGTTTCAGCCTAGTAGAGGTGG + Intergenic
1112189347 13:97160786-97160808 ATTTTACAGCCTTCTGAAGAGGG + Intergenic
1112443068 13:99439050-99439072 ATTTTTCAGCCTACCACGTGTGG + Intergenic
1112600440 13:100850198-100850220 ATTTTTCAGCTTACCTCAAGGGG + Intergenic
1113077936 13:106486870-106486892 CATTTTCAGGCCACTGCAGGCGG - Intergenic
1115631554 14:35250818-35250840 ATTTTTCAGTCTTTTGGAGGTGG + Intronic
1117555686 14:56880804-56880826 ATTTCTGAGCCTACTGCTGAGGG - Intergenic
1118306706 14:64661137-64661159 ACTTTTCTGCCTATTGCAGGAGG + Intergenic
1120039639 14:79738114-79738136 ATTTTTCAACCTACTGCAGGTGG - Intronic
1121882969 14:97516742-97516764 GTTTTTCAGCCTCCTGGATGTGG - Intergenic
1122217968 14:100216431-100216453 AGTTTGCACCCTACTGGAGGTGG - Intergenic
1126477155 15:49077554-49077576 CTATTCCAGCCTACTGCAGTGGG - Intergenic
1127418016 15:58776101-58776123 ATTTTATAGCCTCTTGCAGGTGG - Intronic
1130122132 15:81060111-81060133 ATTTGTCAGCCGACTGAATGTGG - Intronic
1131895782 15:97027839-97027861 ATTTTTAAGCCTATCCCAGGAGG - Intergenic
1132887806 16:2190106-2190128 ATTGATCAGCCTGCTGCTGGAGG - Exonic
1133904102 16:10004898-10004920 TTTATTCAGCCTACTACACGGGG + Intronic
1134275904 16:12775934-12775956 ATTGTTCAGCCTACTGCAGATGG - Intronic
1134304982 16:13023890-13023912 ATTATTCAGCCCACTCCAGATGG + Intronic
1134679692 16:16115676-16115698 GTTCTTAAGCCTCCTGCAGGAGG + Intronic
1135017078 16:18932752-18932774 ATTTTTCAAGCTGGTGCAGGAGG + Intergenic
1135979654 16:27137915-27137937 ATTTTACATACTACTGCAGTTGG + Intergenic
1137893043 16:52182215-52182237 ATTTTTCAGCCTACCATAGTTGG + Intergenic
1137933428 16:52610152-52610174 ATTTTTCACCCTAGAGCAGAGGG - Intergenic
1141290970 16:82717829-82717851 ATTATTCAGCCTACTGTAGTAGG + Intronic
1141452051 16:84111009-84111031 ATTTTTCAGCCTACTGCAGGAGG - Intronic
1144185521 17:12791653-12791675 ATTTTTCAGCCTCATCCATGGGG + Intronic
1146542457 17:33709253-33709275 ATTATTGAGCCCACTGCAGGAGG - Intronic
1150516887 17:65822154-65822176 ATTCTTCATCCTACTGTAGTAGG - Intronic
1151027446 17:70695151-70695173 AATTTTCAAACTAGTGCAGGAGG - Intergenic
1153784361 18:8521360-8521382 ATTATTCAGCCCACCACAGGAGG - Intergenic
1154095441 18:11410323-11410345 ATTATTCAGCCTACTACAGAGGG + Intergenic
1155261614 18:24049072-24049094 ACTTTTCAGCATTCTACAGGTGG + Intronic
1156965755 18:43089835-43089857 AATTTTTAGCCTTCTGCATGTGG - Intronic
1157847048 18:51013768-51013790 ATTATTTAGCCTACTGCACCAGG + Intronic
1159749508 18:72283120-72283142 ATTTTTCAGGTTACTGCAGGAGG + Intergenic
1159830841 18:73276743-73276765 CTTTTTCAGGCCAATGCAGGAGG - Intergenic
1160556264 18:79727301-79727323 GTGTTTCAGCCAAATGCAGGTGG + Intronic
1162854869 19:13460515-13460537 AAATTTCAGCCTAATGCATGTGG + Intronic
1164369490 19:27631160-27631182 ATTTTTCACCATATTACAGGGGG - Intergenic
1168146511 19:54422366-54422388 CATTTTCAGCCACCTGCAGGGGG - Exonic
926572333 2:14543491-14543513 ATTTTTCAGCCTTGTCCAGGAGG - Intergenic
928725238 2:34165093-34165115 ATATTTCAGACCACTGAAGGGGG - Intergenic
928810668 2:35220664-35220686 ATTTTTCAGCCTTCTGCATTCGG - Intergenic
931868162 2:66433576-66433598 ATTTTCCAGTCGACCGCAGGGGG + Intronic
933462588 2:82607671-82607693 GTTTTTCAACCTAGTTCAGGTGG + Intergenic
942051411 2:172144453-172144475 ATTTCTCAGGCTACTTCAGCTGG + Intergenic
942655156 2:178207561-178207583 ATTTTTCAGCCAACTGCAGTTGG + Intronic
943070609 2:183136605-183136627 ACTTTTCTGCCTTCTGCTGGTGG + Intronic
946582253 2:221142305-221142327 ATTATTCAGCCTACGCCAAGAGG + Intergenic
1168959207 20:1857259-1857281 TTTTTGCAGGCTATTGCAGGAGG - Intergenic
1169586535 20:7091867-7091889 TTTTTTCAGCCTACCTCAGATGG + Intergenic
1169859035 20:10132522-10132544 ATTTTTCAGCCTCCTCCAGCTGG - Intergenic
1170632522 20:18077593-18077615 ATTTTTCAGCCTACCACAGTGGG - Intergenic
1171049429 20:21841504-21841526 ATTTTTTAGCCTACTCTAGTTGG + Intergenic
1171824738 20:29884613-29884635 ATATTTCAGACTATTGCATGGGG + Intergenic
1173702300 20:45083558-45083580 ATTATTCAGCCTTCAGGAGGAGG + Intergenic
1174170218 20:48613020-48613042 AGATATCAGCCTATTGCAGGGGG - Intergenic
1174405963 20:50303651-50303673 GTCTTTCAGGCTCCTGCAGGAGG + Intergenic
1175685551 20:61025497-61025519 ACCATTCAACCTACTGCAGGGGG + Intergenic
1177273858 21:18881421-18881443 ATTTTTCCGCAGACTGCAGTGGG + Intergenic
1178036372 21:28587983-28588005 ATCTTTCTGCCAACTGCAGCTGG - Intergenic
1178392892 21:32213981-32214003 ATTATTCAGTCTACCACAGGGGG + Intergenic
1184648972 22:45910984-45911006 ATCATTCAGCCTCCTGCAAGCGG - Intergenic
1184874310 22:47263431-47263453 ATTTATCAGGCATCTGCAGGTGG - Intergenic
1184883049 22:47323960-47323982 AGTATTCAGCCTACTTCAGGGGG + Intergenic
951072881 3:18352808-18352830 ATTTTTCCGCCTGCTGCAGTGGG + Intronic
953003423 3:38955385-38955407 ATTTTACTGCATACTGCATGTGG - Intergenic
953453452 3:43023011-43023033 ATTTTTCAGCCTACTACACATGG - Intronic
954413665 3:50382349-50382371 CTTTGTCTGCCTGCTGCAGGTGG - Intronic
956641785 3:71422571-71422593 AGTTTTCAGCCTTGTTCAGGTGG - Intronic
956690734 3:71875773-71875795 ATTTGTCTCCCTGCTGCAGGGGG - Intergenic
957398373 3:79675356-79675378 ATTATTCAGTCTAATGGAGGAGG + Intronic
958750316 3:98187524-98187546 TTCTTTTAGCCTACTGTAGGAGG + Intronic
962414543 3:135169954-135169976 ATCTTTCTGCCTCCTGCAGTGGG - Intronic
963473464 3:145773748-145773770 TTTATTCAGCCTTCTGCAGTAGG - Intergenic
963776781 3:149447993-149448015 AATTATCGGCCTACTGCAGGTGG - Intergenic
963905631 3:150771512-150771534 TTATTTCAGACTACTTCAGGGGG + Intergenic
966595340 3:181720350-181720372 ATTTTTCTGCCTTCTGCGGGTGG - Intergenic
967286106 3:187872133-187872155 CTTTTTCAGCCTTCTAGAGGTGG + Intergenic
967968463 3:194982459-194982481 ATTTTTCAGCCTACCAAAGATGG - Intergenic
968176306 3:196552563-196552585 GTTTTTCAGCCTTCTACAGGTGG + Intergenic
968832786 4:2941813-2941835 AGTTTTCAGCCTAGTGGAAGTGG - Intronic
970328856 4:14957852-14957874 ATTTTTCTGCCTATTGTAGAAGG - Intergenic
972181466 4:36472043-36472065 ATTCTTTAGCCTATTACAGGAGG + Intergenic
972893877 4:43594786-43594808 ATTATTCAGCCTACTGATGGTGG + Intergenic
973026236 4:45275656-45275678 ATTATTCAGCCTACACCATGTGG + Intergenic
973272033 4:48271135-48271157 ATCTTTCCGCCAGCTGCAGGTGG + Intergenic
974482496 4:62464482-62464504 ATTATTCAGCCTATTGTAGTTGG - Intergenic
980204001 4:129694069-129694091 ATTTTTGAGGCTACTGCAATAGG - Intergenic
980637813 4:135531678-135531700 ACTATTCAACCCACTGCAGGTGG + Intergenic
980913494 4:139014128-139014150 ATTTTTCAGCAAACTTCAGAGGG + Intergenic
981098167 4:140802906-140802928 ATTATTCAGCCTACCACAGAAGG + Intergenic
983153982 4:164321373-164321395 ATTTTTCAATCTACTATAGGAGG - Intronic
988013867 5:25528212-25528234 ATTTTTCAGCCTGCGGCTTGCGG + Intergenic
994511272 5:100706951-100706973 ATTTACAAGCCTACTGAAGGAGG - Intergenic
994797598 5:104324354-104324376 ATTATTTAGCCTACTACAGAGGG + Intergenic
995247378 5:109950088-109950110 AAATTTCAGCCCACTTCAGGAGG - Intergenic
996457969 5:123707019-123707041 ATTTTTCTGCCTACTGTGGAAGG - Intergenic
997928864 5:138055712-138055734 ATTTATCAGTCTGTTGCAGGTGG - Intergenic
999210695 5:149886101-149886123 ATTATTCTGCCTGCTACAGGAGG + Intronic
999756561 5:154668981-154669003 ATTTCTCAGCCTACTACAGTAGG + Intergenic
1000652753 5:163837416-163837438 ATTTTTCAGACTCCTGCAGTTGG + Intergenic
1001760634 5:174205216-174205238 ATTTCTCAACCTCCTGCAGAGGG + Intronic
1011408930 6:87045600-87045622 TTTTTTCAGCTTACTGCATATGG - Intergenic
1012355856 6:98313479-98313501 ATATTTCAGCTTTCTGTAGGAGG - Intergenic
1012866335 6:104622661-104622683 ATTTTCCAGGCTATTGAAGGAGG - Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1017046904 6:150355689-150355711 ATGTTGTAGACTACTGCAGGAGG + Intergenic
1017078037 6:150637956-150637978 ATTTTCCAGCCTACTGAATGAGG + Intronic
1020030167 7:4927102-4927124 ATTCTCCAACCCACTGCAGGGGG + Intronic
1021738613 7:23663145-23663167 ATTATTCAGCCTACCACAGAGGG + Intergenic
1023173071 7:37408568-37408590 ATTATTCAGCCTAAAGCAGAAGG + Intronic
1023451129 7:40286538-40286560 TATTTTCAGCCTACCACAGGTGG + Intronic
1026564004 7:71474719-71474741 ATTTTTCAGCCCATTGCTGTAGG - Intronic
1028304006 7:89238877-89238899 ACTTTCCAGACTATTGCAGGAGG + Intronic
1030849864 7:114470616-114470638 ATTTTTCAGACTACTGCCAGAGG + Intronic
1031134150 7:117867649-117867671 ATGTTTCAGCCCACTCTAGGGGG + Intronic
1032276772 7:130464007-130464029 CTTTATCAGGGTACTGCAGGAGG - Intergenic
1035748308 8:1977493-1977515 ATTGTTCTGACTACTGCAGGAGG - Intronic
1042109207 8:65361403-65361425 ATTGTTCTGCCTACTGCAGATGG + Intergenic
1043030364 8:75127110-75127132 ATTATTCTGCCTACTGTAAGAGG - Intergenic
1043604363 8:81982410-81982432 GTTTTTAAGCCTCCTGCATGTGG + Intergenic
1047591121 8:126328686-126328708 ATTTTTGAGCTTGCTGCTGGAGG - Intergenic
1049338759 8:142100663-142100685 AATTTCCAGCCCACTTCAGGAGG - Intergenic
1050084552 9:1951004-1951026 AGTTTACAGCCTAGTGTAGGAGG + Intergenic
1051633558 9:19161645-19161667 ATTATTAAGAGTACTGCAGGTGG - Intergenic
1055269778 9:74544802-74544824 ATTTGTTATCCTTCTGCAGGTGG - Intronic
1055432719 9:76260246-76260268 ATTATTCTGCCTACTACAGATGG - Intronic
1055791167 9:79924758-79924780 ATTTTCCTGCCTAATGCAGGTGG - Intergenic
1056893148 9:90514912-90514934 CTTTTTCTGCATGCTGCAGGGGG + Intergenic
1059014082 9:110495214-110495236 GTTATTCAGCCTACTACATGGGG - Intronic
1061462084 9:130747884-130747906 ATTTTTTAGCCTACTACACTTGG + Intronic
1203707963 Un_KI270742v1:69454-69476 AGTTCTGAGCCTGCTGCAGGGGG - Intergenic
1186125876 X:6413355-6413377 ATTATTCAGCCTACCCCAGAGGG - Intergenic
1186341036 X:8646368-8646390 CTTTATCTGCCTACTACAGGTGG - Intronic
1186379263 X:9039912-9039934 ATTATTCTACCTACTACAGGTGG + Intronic
1186498551 X:10032170-10032192 ATTTTTCAGGTGCCTGCAGGAGG + Intronic
1189033060 X:37469277-37469299 ACTTTTCAGCCTCCTAGAGGAGG - Intronic
1192709232 X:73562898-73562920 ATTATTAACCCAACTGCAGGCGG - Intergenic
1196083785 X:111661820-111661842 ATTATTCAGCCTACCACAGTTGG - Intergenic
1196353074 X:114755672-114755694 ATTTTTCACCCTACTACAACTGG + Intronic
1196599170 X:117582393-117582415 ATTTTTCAGACAAATGCAGAGGG - Intergenic
1197895762 X:131312670-131312692 ATTATTCTGCCTACTACTGGAGG + Intronic
1200695668 Y:6356493-6356515 AGTTTTCTGCCTGCAGCAGGAGG - Intergenic
1200710569 Y:6481309-6481331 AGTTTTCTGCCTGCAGCAGGAGG + Intergenic
1200884950 Y:8258508-8258530 AGTTTTCTGCCTGCAGCAGGAGG + Intergenic
1201023366 Y:9680678-9680700 AGTTTTCTGCCTGCAGCAGGAGG - Intergenic
1201039609 Y:9818217-9818239 AGTTTTCTGCCTGCAGCAGGAGG + Intergenic
1201607531 Y:15803555-15803577 ATTATTCAGCCTACCCCAGAGGG - Intergenic
1201901329 Y:19047868-19047890 AGGTTTCTGCCTACTGCAGCTGG - Intergenic