ID: 1141453111

View in Genome Browser
Species Human (GRCh38)
Location 16:84118903-84118925
Sequence TGGGGTAGAACAGTGATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141453102_1141453111 23 Left 1141453102 16:84118857-84118879 CCTTTAGTCACTATGCCATTGAA No data
Right 1141453111 16:84118903-84118925 TGGGGTAGAACAGTGATTGCAGG No data
1141453109_1141453111 -7 Left 1141453109 16:84118887-84118909 CCCTACAGCTGGAAACTGGGGTA No data
Right 1141453111 16:84118903-84118925 TGGGGTAGAACAGTGATTGCAGG No data
1141453101_1141453111 24 Left 1141453101 16:84118856-84118878 CCCTTTAGTCACTATGCCATTGA No data
Right 1141453111 16:84118903-84118925 TGGGGTAGAACAGTGATTGCAGG No data
1141453110_1141453111 -8 Left 1141453110 16:84118888-84118910 CCTACAGCTGGAAACTGGGGTAG No data
Right 1141453111 16:84118903-84118925 TGGGGTAGAACAGTGATTGCAGG No data
1141453104_1141453111 8 Left 1141453104 16:84118872-84118894 CCATTGAATACATGGCCCTACAG No data
Right 1141453111 16:84118903-84118925 TGGGGTAGAACAGTGATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141453111 Original CRISPR TGGGGTAGAACAGTGATTGC AGG Intergenic
No off target data available for this crispr