ID: 1141453351

View in Genome Browser
Species Human (GRCh38)
Location 16:84120351-84120373
Sequence CTGCTCACTGACCCAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141453351_1141453354 7 Left 1141453351 16:84120351-84120373 CCAGCTTCTGGGTCAGTGAGCAG No data
Right 1141453354 16:84120381-84120403 GTTCCAACAAGCACAGCCTAGGG No data
1141453351_1141453353 6 Left 1141453351 16:84120351-84120373 CCAGCTTCTGGGTCAGTGAGCAG No data
Right 1141453353 16:84120380-84120402 TGTTCCAACAAGCACAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141453351 Original CRISPR CTGCTCACTGACCCAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr