ID: 1141454510

View in Genome Browser
Species Human (GRCh38)
Location 16:84131285-84131307
Sequence CAGTTTCTACCTCTTGTACA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 248}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141454510_1141454517 11 Left 1141454510 16:84131285-84131307 CCCTGTACAAGAGGTAGAAACTG 0: 1
1: 0
2: 2
3: 17
4: 248
Right 1141454517 16:84131319-84131341 CATGGCAACCTGCAGGGAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 336
1141454510_1141454512 -7 Left 1141454510 16:84131285-84131307 CCCTGTACAAGAGGTAGAAACTG 0: 1
1: 0
2: 2
3: 17
4: 248
Right 1141454512 16:84131301-84131323 GAAACTGTCAACAGCAGCCATGG 0: 1
1: 0
2: 1
3: 21
4: 219
1141454510_1141454513 4 Left 1141454510 16:84131285-84131307 CCCTGTACAAGAGGTAGAAACTG 0: 1
1: 0
2: 2
3: 17
4: 248
Right 1141454513 16:84131312-84131334 CAGCAGCCATGGCAACCTGCAGG 0: 1
1: 0
2: 4
3: 20
4: 289
1141454510_1141454514 5 Left 1141454510 16:84131285-84131307 CCCTGTACAAGAGGTAGAAACTG 0: 1
1: 0
2: 2
3: 17
4: 248
Right 1141454514 16:84131313-84131335 AGCAGCCATGGCAACCTGCAGGG 0: 1
1: 0
2: 2
3: 22
4: 240
1141454510_1141454516 10 Left 1141454510 16:84131285-84131307 CCCTGTACAAGAGGTAGAAACTG 0: 1
1: 0
2: 2
3: 17
4: 248
Right 1141454516 16:84131318-84131340 CCATGGCAACCTGCAGGGAGAGG 0: 1
1: 0
2: 1
3: 40
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141454510 Original CRISPR CAGTTTCTACCTCTTGTACA GGG (reversed) Exonic
901142175 1:7042339-7042361 CTGTTTCTTCCTCTTGTTCCTGG + Intronic
901533949 1:9870806-9870828 CAGTTTCTCTCTCCTGGACAGGG + Intronic
902747283 1:18482300-18482322 CAGGTTCTGCCTCTTGGCCAAGG - Exonic
903260820 1:22130984-22131006 CAGTTTCCTCCTCTTTTAAATGG - Intronic
903880688 1:26507088-26507110 CACTTTTTACATCTTGCACAAGG - Intergenic
904091169 1:27945982-27946004 CAGTTTCTGCTTCCTGTCCAAGG + Intronic
904265627 1:29317123-29317145 CAGTTTCTTTCTCTTGTTCTTGG - Intronic
904678654 1:32213985-32214007 CAGTTTCCACCTCTGGAAAATGG - Intronic
905127964 1:35729222-35729244 CACTTTCTACCCCTTGGACTAGG + Intronic
905161826 1:36042779-36042801 CAGTTTCAACATCTTGTAAGAGG - Intronic
906734902 1:48116019-48116041 AAGTTTCCACCTCTTTTCCATGG + Intergenic
909578836 1:77208510-77208532 CAGTTATTGCCTCTTGAACATGG + Intronic
910218050 1:84862464-84862486 CAGTTTCTCCATCTGGTAAATGG + Intronic
910701761 1:90082882-90082904 CAGTTTCTACCTCTGGGAGAAGG - Intergenic
911757286 1:101573512-101573534 GAGTTTCCACCACTTGTTCAAGG - Intergenic
911766596 1:101683628-101683650 CAGTTCCTACCTAATGTACTGGG - Intergenic
914729949 1:150361401-150361423 CAGTTTCTAACTCTTGACCTCGG + Intergenic
914943766 1:152045773-152045795 AAGTTTCTCCCACTTGAACAAGG - Intronic
915843993 1:159243088-159243110 AATTTTCTACCTATTGTAAATGG + Intergenic
916616575 1:166447647-166447669 CAGTTTCTATCTTCTGTATATGG + Intergenic
917253646 1:173090401-173090423 CAGTTTCAATCTTTTGTATATGG + Intergenic
917485865 1:175454064-175454086 CAGTTTCTCCATCTTCTAAATGG + Intronic
919304232 1:195809251-195809273 CAGTTTCTCCTTCTTTTACAGGG - Intergenic
921764473 1:218954071-218954093 CAGTTTCTACCTCTCCAAAATGG - Intergenic
923109085 1:230876706-230876728 CAGTTTCTTCCTCTTTAAGATGG + Intergenic
923303711 1:232668386-232668408 CAGTTTCTACCTCTGTAAGATGG + Intergenic
923864170 1:237921081-237921103 CAGTTTCTTCCTCTTTAACATGG + Intergenic
1064128410 10:12685413-12685435 GAGTTTCTGCATCTTTTACAAGG + Intronic
1064700957 10:18021167-18021189 CAGTTTCTATCTTCTGCACATGG + Intronic
1068493550 10:57755465-57755487 CAGTTTCCACCTCCTGTTCAAGG + Intergenic
1070010483 10:72469046-72469068 CAGTTTCTACATCCAGAACATGG + Intronic
1070599635 10:77856720-77856742 CAATTACTACCTCTTGTCAAAGG + Exonic
1070742134 10:78910145-78910167 CAGTTTCCACATCTGGTAAAGGG + Intergenic
1073907000 10:108293396-108293418 AAGTTTCTACCTCTAATACTAGG - Intergenic
1074739621 10:116472907-116472929 TTGTTTCTACCTCTTCTTCATGG + Intronic
1075120339 10:119660000-119660022 CAGTTCCTACCTCTGCCACATGG + Intronic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1079944282 11:26722212-26722234 CAGTGTCTTCCTCTTGAAGAAGG + Intronic
1080615277 11:33940296-33940318 CAGTTTCTTCATCTGGTAAATGG - Intergenic
1081828987 11:46089988-46090010 CAGTTTCTACCTCTGCTTCCTGG + Intronic
1082620124 11:55410297-55410319 CAGTTTCTTCCTAATGTCCATGG + Intergenic
1083642221 11:64151607-64151629 CAGTTTCTACCTCTGTGAAATGG - Intronic
1089152820 11:116377313-116377335 CAGTGTCTGCCACTTCTACATGG - Intergenic
1090180568 11:124695577-124695599 CACTTTCTACCTTTTGTATTGGG - Exonic
1090276700 11:125425153-125425175 CAGTGACTAACTCTTGGACATGG - Intronic
1091061192 11:132463956-132463978 CAGTTTCTTCATCCTGTAAATGG + Intronic
1091557706 12:1587535-1587557 CAGTTTTTTCCTCTTTTCCAGGG - Intronic
1094042645 12:26133759-26133781 CACTTTCCACATCTTGCACAAGG + Intronic
1097348349 12:58519958-58519980 CAGTTTCCCCATCTTTTACAGGG - Intergenic
1101637302 12:106555081-106555103 CAATCTCTACCTCTTTCACATGG + Intronic
1101855314 12:108437687-108437709 TGGTTTCTACCTCTTTTCCAGGG + Intergenic
1103141920 12:118556098-118556120 CAGTTTCCACACCTTGAACATGG - Intergenic
1103368245 12:120398664-120398686 CAGTTTCCACCTCTGGAAAATGG - Intergenic
1103762332 12:123259995-123260017 CATCTCCTACCTCTTGTAAAAGG + Intergenic
1105722483 13:23130770-23130792 CCTTTTCCACCTCTTCTACACGG + Intergenic
1106662193 13:31811115-31811137 CAGTTTCTCCCTCTTGGAATGGG + Intergenic
1108404498 13:50086229-50086251 CATTTGCTTGCTCTTGTACATGG + Intronic
1108495866 13:51024907-51024929 CACATTCTGCCTCTTGAACATGG - Intergenic
1109613350 13:64795638-64795660 AAGTTTCTTCCTTATGTACATGG - Intergenic
1110259125 13:73465442-73465464 CAGTTACTGCCTGTTGTAAAGGG - Intergenic
1110789204 13:79568830-79568852 CAGTTTATTCCACTTGTACCTGG + Intergenic
1111921141 13:94412394-94412416 CTGTTTGTACCTCATGAACAAGG + Intergenic
1113197619 13:107826944-107826966 AATTTTCTACCACTTGTATAAGG - Intronic
1115153391 14:30311311-30311333 CAGTTTCTACCTCATATAGCAGG + Intergenic
1116380970 14:44267492-44267514 CAATTTCCTCCTCTTGTATATGG + Intergenic
1117355058 14:54915753-54915775 CAGTTTCTTCCTCTTCAAAATGG - Intergenic
1118295283 14:64562721-64562743 CAGTTTCTAACACTGGGACATGG + Intronic
1118492127 14:66271374-66271396 CATTTTCTTCCTCTTGAGCAAGG - Intergenic
1118607812 14:67515884-67515906 CAGTTTCTCCATCTTGGAAATGG - Intronic
1121770673 14:96533940-96533962 CAGTTTTTACCTCTTTCATATGG + Intronic
1122764892 14:104061476-104061498 CAGTTTTTGCCTCTTGTATTTGG + Intergenic
1123210616 14:106757052-106757074 TAGTTTCTACCTCTCCTACTTGG + Intergenic
1124446073 15:29734007-29734029 CACTTTCTATCACTTGTAAAGGG + Intronic
1124868280 15:33515474-33515496 TAGTCTCTACCTGTTGTATATGG + Intronic
1127756503 15:62097598-62097620 CAATTTCTCCCTTTTGTCCATGG - Intergenic
1130161062 15:81400712-81400734 CAGGTTCTTCATCTTGTACGTGG + Intergenic
1130573040 15:85065925-85065947 CAGATGCTACCTCTTGCACCTGG + Intronic
1132988090 16:2778256-2778278 CAGTTTCCTCCTGTTGTAGATGG + Intergenic
1134102840 16:11464625-11464647 CAGTTTCTTCATCTTGTATTGGG + Intronic
1135664168 16:24322018-24322040 CAGTTTCCTCATCTGGTACACGG - Intronic
1135698662 16:24612305-24612327 CAGTTTCTCCATCTTGGAAATGG - Intergenic
1135743222 16:24994683-24994705 CAGTTTCTTCCTCTGTAACACGG - Intronic
1137881204 16:52050329-52050351 TAGATTCTACCTCTTGTTGAGGG - Intronic
1140786386 16:78346305-78346327 CAGTTTTTAGCTGTTGTAAATGG + Intronic
1141178468 16:81736212-81736234 TAGTTTCTACCTCTTGAAGGAGG + Intergenic
1141290140 16:82711100-82711122 CAGTTTCTACGTCTTTCTCAGGG + Intronic
1141454510 16:84131285-84131307 CAGTTTCTACCTCTTGTACAGGG - Exonic
1141756533 16:85995060-85995082 CCGCTTGTACCTCTTGTACCTGG - Intergenic
1142920271 17:3178458-3178480 CAGTTTCTTCCTATTCTCCATGG - Intergenic
1144040662 17:11407902-11407924 CAGTTTTCACCTTTTGTATAAGG + Intronic
1146270895 17:31485150-31485172 CAGTCTCTACCTCTAGAAAATGG - Intronic
1148698571 17:49575461-49575483 CCGTTTCCACCTCTTTTGCAGGG - Intergenic
1149172967 17:53834973-53834995 CAGTTTCTATCTTCTGTATATGG + Intergenic
1149310516 17:55388431-55388453 CATTTTCTAGCTCTTATAAATGG - Intergenic
1149948172 17:60954059-60954081 CAGTTTCAACCTTCTGCACATGG + Intronic
1150533362 17:66009660-66009682 CAGTTTCAATCTTTTGTATATGG + Intronic
1152979884 18:267289-267311 CAGCTTCTACCTCATGTACCAGG + Intronic
1156098841 18:33569123-33569145 CAGTTTCTACTTCCAGGACATGG - Intergenic
1158781514 18:60657518-60657540 GAGTTTCTACCTATGGTACATGG - Intergenic
1159301913 18:66583795-66583817 CAGTTTCAATCTTTTGTATATGG - Intronic
1160832274 19:1109505-1109527 CGGCTTCTACCTCTCCTACAAGG - Exonic
1161153048 19:2719646-2719668 CAGTTTCTACCTGCTGCACTGGG + Intronic
1161348854 19:3781444-3781466 CAGTTTCCCCCTCTGGAACAGGG - Intronic
1162922425 19:13911433-13911455 CAGTTTCTCCCTCTGTGACACGG - Intronic
1163174617 19:15555766-15555788 CAGTTTCTACCTCTGTTAAACGG - Intergenic
1163442734 19:17329771-17329793 CGGTTTCTACCTCAAGGACATGG - Exonic
1166823995 19:45598157-45598179 CAGTTTCTCCCTTCTGTAAAAGG + Intronic
1167122285 19:47524953-47524975 CAGTTTCTGACTCATGAACAGGG - Intronic
1167419199 19:49393365-49393387 CAGTTTCTTCCTCTGGAAAATGG - Intronic
1167449784 19:49560351-49560373 CAGTTTCTTCCTCTGGAACATGG + Intronic
1167606683 19:50485040-50485062 CAGTTTCCATCTCTGGTATAAGG + Exonic
1168466636 19:56607535-56607557 CAGTTTCTTCCTCTGTTAAAAGG - Intronic
926530549 2:14039493-14039515 CAGCTGCTACCTCTGGTTCAGGG + Intergenic
926628397 2:15114726-15114748 CAGCTTCTACCTCCTGACCAGGG + Intergenic
928245488 2:29622926-29622948 CAGTTTCTTCCTCTAGAACGTGG + Intronic
930282781 2:49390729-49390751 CAGTTTCAATCTTTTGTATATGG - Intergenic
930985187 2:57577154-57577176 CTGCTTCTACCTCTTCTACAGGG - Intergenic
931015631 2:57976917-57976939 CAGTTTCAATCTTCTGTACATGG + Intronic
933306081 2:80600191-80600213 CAGTTTATGCCTTTTGTATAGGG - Intronic
933442839 2:82334958-82334980 GAGTTTCTCCCTCTTGGTCAGGG - Intergenic
933518944 2:83346203-83346225 CAGTTTCAACTTATTTTACAAGG - Intergenic
933815182 2:86061819-86061841 CAGTTTCTACCCCTCGTCAAAGG - Intronic
934912898 2:98275472-98275494 GAGTTTCTGCCTCTTGTCCTTGG - Intronic
935635442 2:105246365-105246387 CAGTTTCCAGCTCTTGCATAAGG - Intergenic
935934411 2:108166350-108166372 CAGTTTCTGCCTCTGTAACATGG + Intergenic
936581635 2:113705186-113705208 CAGTTTCTACCTGCTGTCCTAGG - Intronic
937236465 2:120434413-120434435 CAGTTTCTCCCTCTTTAAAATGG + Intergenic
939951068 2:148473932-148473954 CAGTTTCTAAATCTGTTACATGG - Intronic
940657283 2:156503183-156503205 AAGTCTCTGCCTCTTGTGCAAGG - Intronic
943589503 2:189780526-189780548 CAGTTTCTACCTGTAGAATAAGG - Intronic
944500347 2:200352987-200353009 CAGCATCTACATGTTGTACATGG + Intronic
944515901 2:200511327-200511349 CTGTTTCTCCCACTTGAACAAGG - Intronic
945492141 2:210468724-210468746 TAGCTTCTACCTCTTGCTCAAGG - Intronic
945843118 2:214912032-214912054 CTGTTTCTTCCTCTTGTATATGG + Intergenic
948596984 2:239086355-239086377 CAGATTCTCCTTCATGTACAGGG - Intronic
1173118280 20:40267181-40267203 CAGTTTCTACCTCTATAAAATGG + Intergenic
1173593026 20:44240252-44240274 GAGTAGCTACCTCTTTTACATGG + Intergenic
1173606860 20:44337704-44337726 CAGTTTCTTCCTCTGGAAAATGG - Intronic
1173771185 20:45659910-45659932 CAGTTTCAACCTCCTGCATATGG + Intronic
1173791723 20:45832416-45832438 CAGTTTCTTCATCTTGAAAATGG + Intronic
1174141071 20:48413978-48414000 CAGTTTCTTCCTCTGTCACATGG - Intergenic
1176146978 20:63569820-63569842 CAGTTTCTTCCTGTGCTACATGG + Intronic
1176223530 20:63981244-63981266 CGGTTTCTTCTTCTTGTTCATGG - Exonic
1177951366 21:27542146-27542168 CAGTTTCTACTTTCTGCACATGG - Intergenic
1178845506 21:36171088-36171110 CAGGTTCAACCACTTGTGCAAGG + Intronic
1179617548 21:42591867-42591889 CATTGTCTACCTGTTTTACAGGG + Intergenic
1181870204 22:25892125-25892147 CAGTTTCTTCCTCTTTCAAATGG + Intronic
1184642886 22:45881535-45881557 CAGTTTCTTCATCTTTAACATGG - Intergenic
1184879966 22:47298452-47298474 CAGCTTCTCCCTCTTGAATATGG - Intergenic
949950834 3:9227469-9227491 CAGTTTCTTCCTCTTTCAAATGG - Intronic
950469692 3:13176942-13176964 CAGTATGTACCTGTTGTACCTGG - Intergenic
951359391 3:21706531-21706553 CAGTTTCTGCCTCTAGTTAAGGG - Intronic
953882963 3:46701124-46701146 CAGTTTCTCCATCTGGGACAAGG - Intergenic
957676692 3:83376980-83377002 CAGTTTCTCCCACTTGTAATGGG - Intergenic
959957690 3:112257493-112257515 CAGTTTCTACCTTCTGTATATGG - Intronic
960144463 3:114185956-114185978 CAGATTCTCCCTCTTCTCCAGGG + Intronic
960598684 3:119433205-119433227 CATTTTCTTCCTCTTGAACCTGG - Intronic
962961618 3:140316258-140316280 GAGTTTCTACCTCTCATGCAGGG - Intronic
967312568 3:188119961-188119983 CTGTTTGTACCTCTGGGACATGG - Intergenic
968001129 3:195207477-195207499 GAGTGTACACCTCTTGTACAAGG - Intronic
968585301 4:1413607-1413629 CAGTTTCTCCCTCTGTGACAGGG + Intergenic
969386531 4:6853427-6853449 CAGTTTCTACATCTGGAAAAGGG - Intronic
969719826 4:8887504-8887526 CAGTTTCCCCCTCCTGTAGATGG - Intergenic
969860656 4:10033099-10033121 CAGTTTCCTCCTTTTGTCCAGGG + Intronic
970008833 4:11436389-11436411 CAGTTTCTTCCTCTGGAAAATGG + Intergenic
971804832 4:31342407-31342429 CAGTTTCTTTCTCTTCTCCATGG - Intergenic
972560133 4:40219701-40219723 CAGATGCTACCTCTTGTATGAGG - Intronic
973723137 4:53745315-53745337 CAGTTTTTACCTCTGGTGAATGG - Intronic
975303690 4:72822616-72822638 CAGTTTCTAGCTCTATGACATGG + Intergenic
978395388 4:108273747-108273769 CAATTTCTTCCTGTTGTTCAAGG + Intergenic
978896770 4:113897961-113897983 CACTTTCTATTTCTGGTACAGGG - Intergenic
978917766 4:114147436-114147458 CAGTTTCTGCCTCGTGCCCATGG - Intergenic
979957542 4:126973127-126973149 CAGTTTCTACCTATTGTTTTTGG - Intergenic
980957048 4:139440072-139440094 CAGATTCTTCCTCTTCTCCAGGG + Intergenic
981045146 4:140257910-140257932 CAGTCTCTGCCTCTTGGGCAAGG + Intronic
982505491 4:156212057-156212079 CAATTTCTATCTCTTGTATATGG - Intergenic
982548788 4:156770276-156770298 CACTTTCTTCCTCTAGTTCAGGG - Intronic
982585565 4:157232907-157232929 CAGTTTCTACCTCTGTAAAAGGG + Intronic
982620257 4:157695038-157695060 CAGTTTCTACCAGAGGTACAAGG + Intergenic
984641880 4:182175621-182175643 CAGTTTCTTCCCCTGGTATAAGG + Intronic
985356301 4:189123103-189123125 CAGTTTCTGCCTCATGGATAGGG + Intergenic
985380657 4:189391445-189391467 CAGTTTCTTCCTCTTGTGAAAGG + Intergenic
986277382 5:6289389-6289411 CAGTTTCTTCCTCATGTATTTGG - Intergenic
986737008 5:10675348-10675370 CAGTTTCCTCATCTTGTAAATGG + Intergenic
986777467 5:11030894-11030916 CAGATTCTTCCTCTTTTCCAGGG + Intronic
988772930 5:34450137-34450159 CAGTTTATGCCTCTTGCCCATGG + Intergenic
989793126 5:45431631-45431653 CAGTTTCAATCTTTTGCACATGG + Intronic
992512493 5:77452213-77452235 CATTTCCTCCTTCTTGTACATGG - Intronic
995039002 5:107567414-107567436 CACATTCTGCCTCTAGTACAAGG - Intronic
996237372 5:121148322-121148344 CAGTTTCAACCTCTTTTATATGG + Intergenic
996469332 5:123841806-123841828 CAGTTTCAATCTTTTGTATATGG - Intergenic
997075329 5:130667920-130667942 CATTTTTTACCTCCTGTAAAAGG - Intergenic
997115961 5:131126084-131126106 CAGTTTCTATCTTCTGTATATGG - Intergenic
997255606 5:132425601-132425623 CAGTTTCTACCTCTATAAAACGG + Intronic
997276665 5:132598787-132598809 CAGCTTCTACTTCCTGTTCATGG - Intronic
998203457 5:140143376-140143398 CACCTTCTCCCTCTTCTACAAGG - Intergenic
999722601 5:154409826-154409848 GACTTTCTACCTTTTGAACATGG - Intronic
1000164546 5:158635134-158635156 CAGTTTCTCCCTCTTGCACAGGG + Intergenic
1000822582 5:166002846-166002868 CAGTTGCTAACACTTCTACATGG + Intergenic
1001045606 5:168369152-168369174 CAGTTTCTCCTTCTGGTAAATGG + Intronic
1001196952 5:169681825-169681847 CAGTTGCTTCCTCATGTGCATGG - Exonic
1001871712 5:175161825-175161847 CAGTTTCTACATCTGTTAAATGG + Intergenic
1003775390 6:9355081-9355103 AATTTTCTACATCTTGTAGATGG - Intergenic
1004092878 6:12523039-12523061 CAGTTTCAATCTTCTGTACATGG + Intergenic
1004462939 6:15855342-15855364 CTGTTTCTCCCTCTTGTCCCTGG + Intergenic
1004614181 6:17274328-17274350 CAGTTTCAACCTTTTGCATATGG - Intergenic
1006023993 6:31135658-31135680 CTGTTTCTAACACTTGTTCAAGG - Intronic
1007427885 6:41759122-41759144 CAGCTTCTACCTCTTCACCAAGG + Intergenic
1008222255 6:48869179-48869201 CACTTTCTACCTCCTATACTGGG - Intergenic
1009694641 6:67086498-67086520 CAGTTTCAACCTTCTGCACATGG + Intergenic
1009739805 6:67729792-67729814 CAGTTTCTACTTTTTATATATGG + Intergenic
1010186317 6:73147395-73147417 CAATTTCTACCTGTGGTAAATGG + Intronic
1010736082 6:79444841-79444863 CAGTTTTTACCTGTAGTTCAGGG + Intergenic
1012035118 6:94126826-94126848 CACTTTTTAGCTCTTGTGCAAGG + Intergenic
1012187345 6:96235572-96235594 CAGTTTCTACCTCTGAAAAATGG - Intergenic
1014685979 6:124500907-124500929 CAAATTCAACCTCTTCTACAAGG - Intronic
1015633095 6:135250709-135250731 CGGTGTCTACCCCTTGTTCAAGG - Intergenic
1017432969 6:154389287-154389309 CAGTTTCCCCCTTTTGCACATGG + Exonic
1018954321 6:168397975-168397997 AAGTATCTCCCTCTTGTACCTGG - Intergenic
1018980995 6:168601646-168601668 CGGTCTCTACCTCTGCTACAGGG - Intronic
1020468148 7:8504532-8504554 CAGTTTCTATCTCTTAGTCATGG + Intronic
1021251118 7:18326782-18326804 TTCTTTCTACCTTTTGTACAGGG + Intronic
1022974052 7:35541085-35541107 CAGTTTCTTCCTCTGGAAAATGG - Intergenic
1023290591 7:38664830-38664852 CAGTTTCTTTCTTTTGTATAAGG - Intergenic
1023471239 7:40522816-40522838 CATTTTCTGCCTCTTGTTGAGGG + Intronic
1025249255 7:57341087-57341109 CAGTTTCCACCTCTGTGACACGG - Intergenic
1028864485 7:95692008-95692030 CATTTTCTACCACTTGTAACTGG + Intergenic
1030764913 7:113396846-113396868 CAGTTTCTAGCTCTAGCTCAGGG + Intergenic
1031039808 7:116827483-116827505 AAGTTTCCACCTTTTATACACGG + Intronic
1031350417 7:120723799-120723821 CAGTTTCTACCTGTTTTCCATGG - Intronic
1031350662 7:120726944-120726966 AATTTTCTTCCTGTTGTACAAGG + Intronic
1034480624 7:151317618-151317640 CAGTTGCTATCTGTTGTCCATGG + Intergenic
1034501920 7:151456291-151456313 CAGTTTCTCCCTTTTGGAAAGGG - Intergenic
1035706950 8:1683118-1683140 CAGTTTCCACTTCCTGTACCTGG - Intronic
1036383161 8:8252758-8252780 CGGTTTCTTCCTCTGGAACATGG - Intergenic
1036569152 8:9964615-9964637 TAGTTTCTACGTCTTTTAGAAGG - Intergenic
1036651633 8:10647793-10647815 CTGTTTGTACATCTTGTTCATGG - Intronic
1037966548 8:23138515-23138537 CAGTTTCTATGTCTTGATCAGGG - Intronic
1038325576 8:26570384-26570406 CTGTGCCTACCTCTTGCACAAGG + Intronic
1038554769 8:28501254-28501276 CAATTTCTCCCTCTAGTAGATGG - Intronic
1039268177 8:35851236-35851258 CAGATTCAATCTTTTGTACATGG + Intergenic
1040659831 8:49558224-49558246 CAGTTTCTTTCTTTTGCACATGG - Intergenic
1043011240 8:74884337-74884359 CTATTTCTACCTCTTGCACAAGG + Intergenic
1046142049 8:110106665-110106687 CAGTTTCAATCTTTTGTATATGG - Intergenic
1047785299 8:128148590-128148612 CAGCTTCTACCTCTTCTGTAAGG + Intergenic
1047937660 8:129798161-129798183 CAATTTCTACCTTTTGTAATGGG - Intergenic
1049630178 8:143649798-143649820 CACTTTCCACCTCTTGGATATGG + Exonic
1049972714 9:835511-835533 CAGTATCTACCTCTGGTTCCTGG + Intergenic
1050698553 9:8308576-8308598 CAGATTCTCCCTCTTCTCCAGGG + Intergenic
1051765384 9:20517241-20517263 CAGTTTCTACCTACTGTAGAGGG + Intronic
1053201277 9:36153164-36153186 CAGTTTCTTCCTCTTCAAAATGG - Intronic
1055690740 9:78827703-78827725 CAGTTTCTACATCTGGGAAATGG + Intergenic
1056740704 9:89252044-89252066 TAGTTTCTACTTCTTGTAGGTGG + Intergenic
1060237213 9:121873245-121873267 CAGTTTCTTCGTCTGGAACAGGG - Intronic
1061229738 9:129308257-129308279 CAGTTTCTCCATCTTGTACATGG - Intergenic
1185853062 X:3507248-3507270 CATTTTCTATCCCTTGTATATGG - Intergenic
1186977937 X:14928306-14928328 CAGTTTCTAGCTGGTGTAAATGG - Intergenic
1189303827 X:39971957-39971979 CCATTTCAACCTCTTGTAGATGG - Intergenic
1189523304 X:41793256-41793278 CAGTTTCTACCTCTGTAAAATGG - Intronic
1189969919 X:46407702-46407724 CAGCTTCTACCTCCTACACAAGG - Intergenic
1190130746 X:47746608-47746630 CTGTTTTTATCTCTTGTACTGGG - Intergenic
1192842150 X:74867578-74867600 CAGTTTCTATCTTCTGCACATGG - Intronic
1193440092 X:81529961-81529983 CAGTTTCAATCTTTTGTATATGG + Intergenic
1194832904 X:98646990-98647012 CTATTTCTACCTATTCTACACGG + Intergenic
1194861894 X:99009692-99009714 CAGTTTTTAGCTCTTCTCCACGG - Intergenic
1195918393 X:109958118-109958140 CAGTTTCTTCCTCTCTAACATGG - Intergenic
1198945540 X:142009213-142009235 CAGTTTCAATCTTCTGTACATGG + Intergenic
1200212935 X:154354902-154354924 CACTTTCGACATCTTCTACACGG - Exonic