ID: 1141455601

View in Genome Browser
Species Human (GRCh38)
Location 16:84139642-84139664
Sequence AAGGATAAACAGTGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 868
Summary {0: 1, 1: 1, 2: 4, 3: 73, 4: 789}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141455591_1141455601 19 Left 1141455591 16:84139600-84139622 CCACTACCTTTGTGGCAATTTGT 0: 1
1: 3
2: 111
3: 584
4: 1591
Right 1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG 0: 1
1: 1
2: 4
3: 73
4: 789
1141455592_1141455601 13 Left 1141455592 16:84139606-84139628 CCTTTGTGGCAATTTGTTACATC No data
Right 1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG 0: 1
1: 1
2: 4
3: 73
4: 789

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141455601 Original CRISPR AAGGATAAACAGTGGGAGGA AGG Intronic
900077848 1:832535-832557 AAGAAAAAAAAGAGGGAGGAAGG - Intergenic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900774943 1:4575799-4575821 AATGATAAACAGTGAAGGGAAGG - Intergenic
900863044 1:5246367-5246389 AAGGATAGAGGGAGGGAGGAAGG - Intergenic
901006590 1:6174657-6174679 ATGGATAGACGGTGGGTGGAAGG + Intronic
901224754 1:7606803-7606825 AAGGATCATCAGGGTGAGGAGGG + Intronic
901472920 1:9470224-9470246 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
901680048 1:10907847-10907869 AGGGATAGAGAGTGGGGGGAGGG + Intergenic
902833122 1:19030250-19030272 AGGGAGAAAAAGTGGGAGGCTGG + Intergenic
902957847 1:19938290-19938312 AAGGATGGAGAGTGGGAGAAGGG - Intergenic
903534102 1:24055253-24055275 AAGTGTTAAGAGTGGGAGGATGG + Intergenic
903599462 1:24524953-24524975 AACATTAAAGAGTGGGAGGACGG - Intronic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
904041111 1:27585784-27585806 AAGAGTTAACAGTTGGAGGAAGG - Intronic
905269752 1:36779826-36779848 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
905397949 1:37679443-37679465 AAGGTTCAACTGTGGGAGGGAGG + Intergenic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905864473 1:41369166-41369188 AAGCAGGAAAAGTGGGAGGAAGG - Intronic
905898151 1:41562496-41562518 AAGGAGAAAGAGAGGAAGGAAGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906908780 1:49924289-49924311 GAGGATGGAGAGTGGGAGGAGGG + Intronic
907960134 1:59271473-59271495 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
909005056 1:70265911-70265933 AAGGAAAGAGAGAGGGAGGAAGG + Intronic
910037286 1:82803587-82803609 CGGGATAAACGGTGGGAGCAGGG + Intergenic
910532217 1:88250469-88250491 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
910701941 1:90084960-90084982 AAGGAAGAAAAGAGGGAGGAAGG - Intergenic
910701947 1:90084987-90085009 AAGGAAGAAAAGAGGGAGGAAGG - Intergenic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
910848240 1:91624709-91624731 AAGAATGAAGGGTGGGAGGAGGG + Intergenic
911196000 1:94996375-94996397 GAGGAAAAGCAGTGGGAAGAAGG + Intronic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
911462275 1:98205936-98205958 AAGGATAAAAAAGGGCAGGAAGG + Intergenic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
911585196 1:99682353-99682375 AGGGATAAAGAATGGGAGGGAGG + Intronic
912084867 1:105987022-105987044 GAGGGTACACGGTGGGAGGAGGG - Intergenic
912248793 1:107989771-107989793 AAGGGTAGACAGTGGGAGAAGGG + Intergenic
912735648 1:112147194-112147216 AAGGAGAAAGAGAGGGAGGGAGG - Intergenic
912957154 1:114163329-114163351 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
912991771 1:114494398-114494420 GAGGATAAGGAGTGGGAGGGAGG + Intronic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
913385279 1:118252424-118252446 AAGGATAAACGCTGAGGGGATGG + Intergenic
913463935 1:119119118-119119140 AAAGATACAGAATGGGAGGATGG + Intronic
913690937 1:121279231-121279253 AAGGAGAAAATGGGGGAGGAAGG - Intronic
914146603 1:145000732-145000754 AAGGAGAAAATGGGGGAGGAAGG + Intronic
914704881 1:150162446-150162468 GAGGAGAAGCACTGGGAGGAAGG - Intronic
914711823 1:150221514-150221536 AAGGAAGGAGAGTGGGAGGAAGG + Intronic
914711841 1:150221563-150221585 AAGGAAGGAGAGTGGGAGGAAGG + Intronic
915041973 1:152976105-152976127 AAGGAGGAATACTGGGAGGATGG - Intergenic
915704441 1:157830514-157830536 AAAGACAGAGAGTGGGAGGAGGG - Intergenic
915707134 1:157855438-157855460 AAGGATGTAAAGTGGAAGGAGGG + Intronic
916127671 1:161585806-161585828 AAGGATAGGCAGTGGTAAGATGG + Intronic
916137589 1:161667610-161667632 AAGGATAGGCAGTGGTAAGATGG + Intronic
916138737 1:161675418-161675440 AGGGAGCAGCAGTGGGAGGATGG + Intronic
916189931 1:162168721-162168743 AAGGAGAAAGAAAGGGAGGAAGG - Intronic
916245069 1:162679187-162679209 GAGGATGGTCAGTGGGAGGAGGG - Intronic
917168186 1:172137789-172137811 AAGGGTAAAAGGTGGGAAGATGG - Intronic
917306076 1:173626936-173626958 AAGGAAAGAAAGAGGGAGGAGGG + Intronic
918354211 1:183690778-183690800 AAGAAAAATCAGTGGGAGAATGG - Intronic
918460827 1:184775030-184775052 AAGGATTAAGAGTGGTAAGAGGG - Intergenic
918540615 1:185627986-185628008 AAGGCTAAAAAGAGGGAGGCTGG - Intergenic
918751928 1:188283007-188283029 AAGAATTAACTCTGGGAGGAGGG + Intergenic
919236391 1:194849830-194849852 AAGGAAGAAAAGAGGGAGGAGGG - Intergenic
919424915 1:197417837-197417859 AAGGATAGAAAGAGGGAAGAAGG + Intronic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920478259 1:206297706-206297728 AAGGAGAAAATGGGGGAGGAAGG - Intronic
921093027 1:211860895-211860917 AAGGATGAACAGGTGGAGCATGG - Intergenic
921197200 1:212769762-212769784 AATGATAAACAATGAGAGAAAGG + Intronic
921236648 1:213138501-213138523 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
921331433 1:214042219-214042241 AAGAAGAGACAGTGGAAGGAGGG - Intergenic
921975592 1:221199536-221199558 GAGGACAAAGAGTAGGAGGAGGG + Intergenic
922159592 1:223068858-223068880 GAGGAAAAGCAGTGGGAGGGTGG + Intergenic
922460494 1:225811338-225811360 AAGTTTAAACAATGGGAGGTGGG - Intronic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
922868270 1:228879464-228879486 GAGGATGGAGAGTGGGAGGAGGG + Intergenic
922945557 1:229510860-229510882 AAGGCTAAGGTGTGGGAGGATGG + Intergenic
923751820 1:236753822-236753844 AAGGAGAAACGAAGGGAGGAGGG - Intronic
923850694 1:237790933-237790955 AAGGAAACACAGTGAGAAGAAGG - Intronic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
1063434383 10:6018634-6018656 AGGGGTCAAGAGTGGGAGGAAGG - Intronic
1063525273 10:6778937-6778959 AAGGAAGAAGAGAGGGAGGAAGG + Intergenic
1064086058 10:12347805-12347827 AAGGAAACACAGTGGGAGGAAGG + Intergenic
1065085590 10:22172449-22172471 AAGGATAGATGGTGGGAGGAGGG - Intergenic
1065592312 10:27276920-27276942 AAGGATGGAGGGTGGGAGGAGGG + Intergenic
1065625019 10:27621194-27621216 AAAGAAAAAGAGTGGGAGGAGGG - Intergenic
1065966968 10:30778662-30778684 AAGAATGAGGAGTGGGAGGATGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068159750 10:53248940-53248962 AATGAATATCAGTGGGAGGAAGG - Intergenic
1068350454 10:55837603-55837625 AAGGATAAACAGAGTTAGGGCGG + Intergenic
1068932947 10:62610361-62610383 AAGGAGGAAGAGTGAGAGGATGG - Intronic
1069567817 10:69475118-69475140 AAAGAAAACCAGGGGGAGGAGGG + Intronic
1069699524 10:70411822-70411844 AAGTATATACATTGGGAGAAGGG - Intronic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070215878 10:74380055-74380077 AAAGACAAAGAGTGGGAGGCAGG - Intronic
1070270298 10:74947661-74947683 AAGGGTAAACTGTAGGAAGAAGG - Intronic
1070953193 10:80447117-80447139 GAGGATAAGCAGTTGCAGGAGGG - Intergenic
1070984707 10:80678717-80678739 AAGGGGAAAGAGTGGCAGGAGGG + Intergenic
1070987008 10:80697787-80697809 AAGGATAAAAAGAGGAAGGAAGG - Intergenic
1071795835 10:89004518-89004540 AAGTATAAACAGTGGGTTGGGGG - Intronic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072280842 10:93863854-93863876 CAGGATAAAGAATGGGAAGAAGG - Intergenic
1072815773 10:98507657-98507679 AAGGATAGAGAGGGGGAGGACGG - Intronic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1073077562 10:100834014-100834036 AAGGAGAGACAGTGGGTGCAGGG + Intergenic
1073440513 10:103549881-103549903 AAGGCCACACAGTGGGTGGAAGG - Intronic
1073748881 10:106501274-106501296 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
1074071119 10:110070733-110070755 AAGGATAAAGATTGGGGGGTAGG + Intronic
1074135543 10:110623334-110623356 AAGGACAGAGAGTAGGAGGAGGG - Intergenic
1074776800 10:116773136-116773158 GAGGAAAAGGAGTGGGAGGAAGG - Intergenic
1074813863 10:117130510-117130532 AAGGAGAAACAGCTGCAGGAGGG - Intronic
1074828036 10:117228631-117228653 AGGGAAAGACAGAGGGAGGAAGG - Intergenic
1075923152 10:126229700-126229722 AAGGAGAAAGAGTGAGTGGAAGG - Intronic
1075994338 10:126864917-126864939 AAGGAGCAAGAGTGGGAGGGAGG - Intergenic
1076330974 10:129666100-129666122 AAGAAAAAACAGTGGCAAGATGG + Intronic
1077163264 11:1123143-1123165 AAGGAAAGACGGAGGGAGGAAGG - Intergenic
1077382857 11:2253648-2253670 TAGCACAAACAGTGGGAGGAAGG + Intergenic
1079179974 11:18183364-18183386 GAGGAAAAAGAGTGGGAGGTAGG + Intronic
1079640976 11:22805044-22805066 TAGGTTAAACAGTGGGAGTTTGG + Intronic
1079826421 11:25201034-25201056 AAGGAGAAAGAGAGGGAGGGAGG + Intergenic
1080057841 11:27925689-27925711 TAGGATAAAAAGATGGAGGAAGG + Intergenic
1080104596 11:28498580-28498602 AAGGACAAATAGGGGTAGGAGGG - Intergenic
1080153555 11:29080112-29080134 AAGGATAGAGGGTAGGAGGAGGG + Intergenic
1080646868 11:34193900-34193922 GAGAAGAGACAGTGGGAGGAGGG - Intronic
1081304130 11:41490704-41490726 AAAAATAAACAATGGGGGGAAGG + Intergenic
1081362623 11:42199126-42199148 AAGGAGTAACAGTGGGCAGAGGG + Intergenic
1081425966 11:42926866-42926888 AGGGAAAGAGAGTGGGAGGAGGG + Intergenic
1082295281 11:50434086-50434108 CAGGATAAAAAGTAGAAGGAAGG + Intergenic
1082716498 11:56620268-56620290 AAGTATATACAATGGGAGAAAGG - Intergenic
1082961839 11:58925495-58925517 AAGGAAAGAAAGTGGGAAGAAGG - Intronic
1085010498 11:73137694-73137716 CAGGTGAAAAAGTGGGAGGAAGG + Intronic
1086020530 11:82224152-82224174 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1086068535 11:82772635-82772657 GAGGGTGAACGGTGGGAGGAGGG - Intergenic
1086121222 11:83306323-83306345 AAGCTTACACAGTGGGAGGGAGG + Intergenic
1086770494 11:90758580-90758602 AAGGATAAAAATTGGGAGTAAGG + Intergenic
1087383814 11:97443889-97443911 AAAGAGAAAGAGTGGGAGAATGG + Intergenic
1087508792 11:99062806-99062828 ATGTATCAAGAGTGGGAGGAGGG - Intronic
1087945001 11:104148735-104148757 GAGGATGAAGGGTGGGAGGAGGG - Intronic
1087959070 11:104325669-104325691 GAGGATGGAGAGTGGGAGGAGGG + Intergenic
1088365213 11:109033123-109033145 GAGGATGGAGAGTGGGAGGAGGG - Intergenic
1088442428 11:109886209-109886231 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1088749971 11:112835184-112835206 AAGGAAGAAGAGGGGGAGGAAGG - Intergenic
1089166403 11:116480622-116480644 ATGGATGAACAGTGGGAAGATGG + Intergenic
1089240216 11:117071559-117071581 AAGGATAAATAGAAGGAAGAAGG + Intronic
1089711643 11:120319130-120319152 AAAGAGAAACACAGGGAGGAAGG - Exonic
1090283192 11:125475583-125475605 GAGGATGAAGGGTGGGAGGAGGG + Intronic
1090372962 11:126269336-126269358 AAGGACACACAGTCGGAGGTTGG - Intronic
1090550332 11:127812583-127812605 ATGGGTAAATAGTGGGAGGGAGG - Intergenic
1091113469 11:132993088-132993110 AAGGCAAACCAGTGGAAGGAGGG - Intronic
1091113810 11:132995462-132995484 AAGGAGAGACAGAGGGAAGAAGG - Intronic
1091553489 12:1554404-1554426 CAGGAGAAAGAGTGGAAGGAAGG + Intronic
1093298818 12:17427581-17427603 AAGGCTAAAGAGGGCGAGGATGG + Intergenic
1093760814 12:22907531-22907553 AAGCATAAAAGGTGGGGGGAAGG + Intergenic
1094192091 12:27708290-27708312 AAGGAAATACACTGGGAAGAGGG - Intergenic
1094209831 12:27877569-27877591 GAGGATAAACTCTGGCAGGAGGG - Intergenic
1094615134 12:32029577-32029599 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1095886677 12:47195501-47195523 AAAGATAATCAGAGGAAGGAGGG - Intronic
1096014923 12:48261952-48261974 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1096239974 12:49954613-49954635 ATGGATCTGCAGTGGGAGGAGGG - Exonic
1096343366 12:50823030-50823052 AAAAAAAAAAAGTGGGAGGAGGG - Intergenic
1096912092 12:54994695-54994717 GAGGGTAATGAGTGGGAGGAGGG - Intergenic
1097644384 12:62218313-62218335 AAGAAAAAACAGTGGAAGAAAGG + Intronic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099680112 12:85816154-85816176 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1099813300 12:87613619-87613641 GAGGGTAAAATGTGGGAGGAGGG - Intergenic
1100762931 12:97829829-97829851 AAGGATAAAGGGAGGAAGGAAGG - Intergenic
1100787049 12:98089787-98089809 AAGAAAAGACAGAGGGAGGATGG + Intergenic
1101215846 12:102581667-102581689 AAGGCGAGAGAGTGGGAGGAGGG - Intergenic
1101759104 12:107644720-107644742 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
1101780771 12:107832938-107832960 ATGGATAAACAGTGAGTGGACGG + Intergenic
1102490449 12:113287121-113287143 AGGGAGAAAGAGAGGGAGGACGG + Intronic
1103047927 12:117753662-117753684 GAGGGTAGACGGTGGGAGGAGGG + Intronic
1103104385 12:118210192-118210214 AAGAAGAAAAAGAGGGAGGAAGG - Intronic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103375596 12:120453146-120453168 AAAGAAAAGCAGTGGGAGAACGG + Intronic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1105716610 13:23071891-23071913 GAGGATAGAGGGTGGGAGGAGGG - Intergenic
1107683997 13:42878624-42878646 AAGGAGAAAGAGAGGAAGGAAGG + Intergenic
1107820983 13:44285469-44285491 AAGGGTCAACAGTGGAAGCAGGG - Intergenic
1107892930 13:44930196-44930218 CAGGTTAGAAAGTGGGAGGAGGG - Intergenic
1108006914 13:45957743-45957765 AAGGAAAAACTATGTGAGGAAGG - Intronic
1108402308 13:50058564-50058586 GAGGATAGAGGGTGGGAGGATGG - Intergenic
1109042672 13:57359564-57359586 AAGGATAAATAGTTGGAGCATGG + Intergenic
1109642862 13:65213098-65213120 AAGGATGGAAAGAGGGAGGAAGG + Intergenic
1109815117 13:67571690-67571712 TAGGATTAAAAATGGGAGGAGGG + Intergenic
1109987166 13:70002806-70002828 AAGAAAAATCAGTGGGAGAATGG + Intronic
1110069324 13:71153646-71153668 GAGGATAGAGGGTGGGAGGAGGG - Intergenic
1110442721 13:75543175-75543197 GAGGGTAGAGAGTGGGAGGAAGG + Intronic
1110811548 13:79816799-79816821 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1110935372 13:81281063-81281085 AGGGATAAAAAGTTGGAGTAAGG + Intergenic
1110955610 13:81549251-81549273 CAGGAGAAACAGTGAGAGGGGGG + Intergenic
1110963452 13:81659944-81659966 GAGGAGAAACAGGGGAAGGATGG + Intergenic
1111039459 13:82726688-82726710 AAGGATGGAGGGTGGGAGGAGGG - Intergenic
1111435143 13:88196829-88196851 GAGGTTGAAGAGTGGGAGGAGGG - Intergenic
1111556344 13:89885899-89885921 AAGAATAAACAGCAGGAGAAAGG - Intergenic
1111640434 13:90962922-90962944 AAGGATATACAGTGTGAGGCTGG - Intergenic
1111736476 13:92146657-92146679 TGGGGGAAACAGTGGGAGGAGGG - Intronic
1111887347 13:94039063-94039085 GGGGAAAAACAGTGGTAGGAAGG + Intronic
1112219133 13:97470353-97470375 AAGGATTAACAGTGGGGAAAAGG - Intergenic
1112782695 13:102918575-102918597 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1113542309 13:111118363-111118385 AAGGTTAGACAGTGAGAAGATGG + Intronic
1114382684 14:22224649-22224671 GAGGATGAAGGGTGGGAGGAAGG - Intergenic
1114814923 14:25945769-25945791 AAGGAGAGACAGTGGAAGAAGGG + Intergenic
1115178237 14:30590704-30590726 AAGGAAGAACCGTGGGAGAAAGG + Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115940556 14:38603746-38603768 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1116260367 14:42616945-42616967 AAGGAAAAAGTGTGGGAAGAGGG - Intergenic
1116467937 14:45254596-45254618 AAGGAAAAACAGTTGGAGGTAGG + Intergenic
1116909440 14:50444104-50444126 AAAGACAAATAGTGGGAGAAAGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116995075 14:51314837-51314859 TATAATAAACAGTGGGAGGGAGG + Intergenic
1117051939 14:51869382-51869404 AAGGTGTCACAGTGGGAGGAAGG - Intronic
1117262833 14:54054538-54054560 AAGCATGAAGGGTGGGAGGAGGG - Intergenic
1117275264 14:54187545-54187567 AAGGATAAACATTTGTAAGAAGG + Intergenic
1117506567 14:56409605-56409627 GAGGATGAAGGGTGGGAGGAGGG + Intergenic
1117518359 14:56525232-56525254 AAACAGAAACAGTGGGAGGCTGG + Intronic
1117819421 14:59632320-59632342 AATGAAAAAAATTGGGAGGAGGG - Intronic
1118665915 14:68069428-68069450 AAGGGTGGAGAGTGGGAGGATGG - Intronic
1118893531 14:69927942-69927964 AAGAATAAACAGAGGGGTGAAGG + Intronic
1119219214 14:72893021-72893043 AAGGATGAAAAGGAGGAGGAAGG + Intronic
1119364948 14:74084013-74084035 AAGGAAAGACGGTGGGCGGATGG + Intronic
1119615420 14:76095804-76095826 AAGGACAGACAGTAGGAGGGTGG - Intergenic
1120336101 14:83157065-83157087 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1120617341 14:86723619-86723641 AAGGAAAGGCAGTGGGAGGATGG + Intergenic
1120677908 14:87443410-87443432 AAGGAAAGAAAGAGGGAGGAAGG + Intergenic
1120689849 14:87580409-87580431 AAGGATGGACATCGGGAGGATGG + Intergenic
1120997976 14:90431097-90431119 AATGTGAAACAGTGTGAGGAAGG - Intergenic
1121007490 14:90499656-90499678 AAGGATAAAGAGTGGATGGATGG + Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1121808272 14:96852433-96852455 AAGGAGAAACAGTCACAGGAAGG + Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122011671 14:98754345-98754367 AAGTAGAAACAGAGGGTGGAAGG + Intergenic
1122403432 14:101481333-101481355 AAGGATACACAGTGGGTCAACGG - Intergenic
1124127876 15:26954160-26954182 AACAATAAATAGTGGGAGAAAGG + Intergenic
1124228827 15:27922955-27922977 GAGGATGAAAGGTGGGAGGAGGG - Intronic
1124469574 15:29971156-29971178 AGGGATAAACTGTGGAGGGAGGG - Intergenic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125303454 15:38282613-38282635 ATGGATAAGCAGTGGTAGGATGG + Intronic
1125561132 15:40634543-40634565 AAGGATAGAAATTGGGAAGATGG + Intronic
1125992610 15:44124368-44124390 AAGGAAAAAAAGAGGTAGGAAGG + Intronic
1126689720 15:51279970-51279992 AAGGAGAAACAGAGAGAGAAGGG + Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127818229 15:62631717-62631739 AAGAAGAAAAAGCGGGAGGAGGG - Intronic
1127821234 15:62658123-62658145 AAGGAAAAAAAGGGGGTGGAGGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1129169102 15:73797108-73797130 AAGGAACAGCTGTGGGAGGAGGG - Intergenic
1129635458 15:77311969-77311991 AGGGATGAACACTGGGAGTAGGG + Intronic
1129785139 15:78304760-78304782 CAGGATAACCAGTGGGCAGAGGG + Intergenic
1129911175 15:79227767-79227789 AAGGACAATCACTGGGAAGAGGG - Intergenic
1129988413 15:79939643-79939665 AAGAAAAGACAGAGGGAGGAAGG + Intergenic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1132799929 16:1747004-1747026 AAGGCCAAACACAGGGAGGAGGG - Intronic
1132953593 16:2578780-2578802 CAGGAAAAACTGTGGGAGGTGGG + Intronic
1132960758 16:2621387-2621409 CAGGAAAAACTGTGGGAGGTGGG - Intergenic
1133087125 16:3373545-3373567 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1133481021 16:6170736-6170758 GAGGATAGAGGGTGGGAGGAGGG - Intronic
1133882363 16:9794928-9794950 AAGGATGAAGAGGAGGAGGAGGG + Intronic
1133944030 16:10333737-10333759 AAGGAGACACCCTGGGAGGAAGG + Intronic
1134069520 16:11252134-11252156 AAGAATGAAAAGTGAGAGGAGGG - Intronic
1134288001 16:12879208-12879230 AAGGAGGAAGAGAGGGAGGAAGG - Intergenic
1134686941 16:16165638-16165660 GAGGAGAAACAGTGGCAGGATGG + Exonic
1135064550 16:19298639-19298661 AAGGAAACAGACTGGGAGGAAGG - Intronic
1135461195 16:22644750-22644772 GAGGATAGAGGGTGGGAGGAGGG - Intergenic
1135899967 16:26448346-26448368 GAGGAAAAAGAGTGGGAGAAGGG - Intergenic
1135938740 16:26802992-26803014 AAGGATAAAAGGAGGAAGGAAGG + Intergenic
1135939525 16:26809449-26809471 AAGGATGAAAAGGGGGAGGAAGG + Intergenic
1136418722 16:30118805-30118827 AATAATAAACTGTGGGAGGCAGG + Intronic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1137926223 16:52545605-52545627 AAAGAAAAAGAGAGGGAGGAGGG + Intronic
1138217369 16:55215950-55215972 AAAGATATGCAGTCGGAGGAAGG - Intergenic
1138600538 16:58051522-58051544 AAGGAGAAAGGGAGGGAGGAAGG + Intergenic
1139218927 16:65158811-65158833 AAGGATAAATGGTGAGGGGAGGG + Intergenic
1139265174 16:65631684-65631706 AACGATATGCACTGGGAGGATGG - Intergenic
1140628804 16:76827421-76827443 AAAGACAAATAGTGGGAGAAGGG + Intergenic
1141161081 16:81629545-81629567 AAGGAGACAGAGAGGGAGGAAGG - Intronic
1141346195 16:83248276-83248298 AAGGAGAAACAGAGGCAGGGGGG + Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1141642278 16:85348281-85348303 ATGGATGAACAGTGGATGGATGG - Intergenic
1142109915 16:88325781-88325803 AAGGAGAAAGAGGGGAAGGAAGG - Intergenic
1143943481 17:10568196-10568218 AAGGCCAAACACTGGGAGGCAGG + Intergenic
1144225547 17:13141538-13141560 AAGGAGAAAAATTAGGAGGAAGG - Intergenic
1145230493 17:21170161-21170183 AGGGATAAACAGTGGGAGGCAGG - Intronic
1145853549 17:28129125-28129147 AAGTAAAAACAGTGCCAGGATGG + Intronic
1146807749 17:35878788-35878810 ATGGATAAACAGTGGCAGAGTGG + Intronic
1146834682 17:36100800-36100822 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1146849290 17:36207985-36208007 AAGGGTGAAGGGTGGGAGGAGGG - Intronic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147385285 17:40077496-40077518 AGGGATATACCCTGGGAGGAAGG - Exonic
1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG + Intergenic
1148545756 17:48517705-48517727 AAGGATAAAAAGAGGGAAGTGGG + Intergenic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149462076 17:56836988-56837010 AAGGAAAAACTGGGGGAGGAGGG - Intronic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1150645751 17:66976529-66976551 AAGAATAAAGAGAGGAAGGAGGG - Intronic
1150977812 17:70108788-70108810 AAGGAGAAAGGGAGGGAGGAAGG - Intronic
1151981835 17:77516347-77516369 GAGGATGAAGGGTGGGAGGAGGG - Intergenic
1152482553 17:80564738-80564760 GAGGGTAGACGGTGGGAGGAGGG - Intronic
1153505483 18:5792665-5792687 GAGGATGAAGAGTGGGAGGAGGG + Intergenic
1153589366 18:6657150-6657172 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1153987797 18:10368627-10368649 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
1154205760 18:12335456-12335478 AAGGGGAAAGAGTGGCAGGAAGG - Intronic
1155125027 18:22865836-22865858 AAGCATAAACAGTAGGAGGCAGG - Intronic
1155463227 18:26107076-26107098 GAGTATGAAAAGTGGGAGGAGGG - Intergenic
1155464077 18:26116121-26116143 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1155680616 18:28481762-28481784 CAGGATTAACAGTGGCAGCATGG - Intergenic
1155813770 18:30276298-30276320 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1156422645 18:36971855-36971877 AAAGGTAAAGGGTGGGAGGAAGG + Intronic
1156632884 18:38991527-38991549 AAGGAGGAAGAGAGGGAGGAGGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157412541 18:47475606-47475628 ATGGATAAACAGGGGGAAGTGGG - Intergenic
1157415474 18:47498810-47498832 AATGATAAAGAATGGGAGGATGG - Intergenic
1157509719 18:48262196-48262218 AAGGCTGCACAGTGAGAGGACGG + Intronic
1158888901 18:61855114-61855136 AATTATAACCAGTGGGAAGAAGG + Intronic
1159032244 18:63243362-63243384 GAGGATGAAGGGTGGGAGGAGGG + Intronic
1159272972 18:66176718-66176740 AGGGATAAACCATGGGATGATGG - Intergenic
1159531683 18:69663293-69663315 GAGGATGAAGGGTGGGAGGACGG + Intronic
1159544392 18:69820893-69820915 AAGGATAGAGGGTGGGAGAAGGG + Intronic
1159703676 18:71660685-71660707 AAGAATAAACAATGGGAGAGAGG - Intergenic
1163402897 19:17105036-17105058 AGGGATGAACAGGGGGAGCATGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163953653 19:20613959-20613981 AAGGAGAAAGAGTGTGAGAAGGG + Intronic
1164491522 19:28719419-28719441 AAGGATAAGCATTTGAAGGAAGG + Intergenic
1164541990 19:29128317-29128339 GAGGACTCACAGTGGGAGGATGG + Intergenic
1165969698 19:39616723-39616745 AAGGAGAAAGTGTGGGAAGAAGG - Intergenic
1166192335 19:41183310-41183332 CAGGATGAGCAGTGGGATGAGGG + Intergenic
1166201229 19:41239040-41239062 AAGGATGAGGAGTTGGAGGATGG + Intronic
1166546750 19:43638884-43638906 AGGGATAGAGAGAGGGAGGAAGG + Intronic
1166863140 19:45821161-45821183 AAGGGTAAAACCTGGGAGGAAGG + Intronic
1167820405 19:51922511-51922533 AAGGATAAACAGAGCGAGTCTGG + Intronic
1167918080 19:52758619-52758641 GAGGGTAGAGAGTGGGAGGAAGG + Intergenic
925799404 2:7583262-7583284 CAGGAGAAAGAATGGGAGGAAGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926312488 2:11684746-11684768 AATGAAAAACAATGGAAGGAAGG - Intronic
926402425 2:12511689-12511711 AAGGACAAACATTAGGGGGAAGG - Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
927325283 2:21798367-21798389 AATAATATCCAGTGGGAGGATGG + Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
927713311 2:25339047-25339069 AAGGAGAGGCAGTGTGAGGAGGG - Intronic
927842244 2:26453158-26453180 CAGGAGAAAGAGTGGGAAGAAGG - Intronic
928592378 2:32830834-32830856 GAGGATAGAGACTGGGAGGAGGG + Intergenic
928661137 2:33502813-33502835 AAGGTTAAAGAGTTAGAGGAAGG - Intronic
929135645 2:38621429-38621451 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
929184101 2:39075193-39075215 AGGCACAAACAGTGGGAGGTGGG + Intronic
929336664 2:40756438-40756460 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
929484114 2:42339572-42339594 AGGGATAAAGGGAGGGAGGAAGG - Intronic
930005698 2:46894747-46894769 AAGGAAAAACAATGGAATGACGG - Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
930941938 2:57024230-57024252 AAAGATACACAGTGGCAAGATGG - Intergenic
931093823 2:58917298-58917320 AAGGCTAAACACCAGGAGGATGG - Intergenic
931254417 2:60557278-60557300 CAAGATAAAAAGGGGGAGGAGGG - Intergenic
931493076 2:62771010-62771032 AAGGGTGAAGGGTGGGAGGAGGG + Intronic
931854634 2:66289010-66289032 ATGGATAGAGAGTAGGAGGATGG - Intergenic
932937257 2:76118730-76118752 TAGGGTAGAGAGTGGGAGGAGGG + Intergenic
933057597 2:77692346-77692368 AAGCATAACCAGTGGTATGAAGG + Intergenic
933101577 2:78265644-78265666 AAGGGTGGAGAGTGGGAGGAGGG + Intergenic
933127406 2:78626511-78626533 ATGAATAAAAAATGGGAGGAAGG + Intergenic
933182224 2:79240362-79240384 GAGGATAGAGGGTGGGAGGAAGG - Intronic
933576276 2:84072119-84072141 AAGGAAAAAAAGAGGGAGGTAGG + Intergenic
933740853 2:85532800-85532822 AAAGATAAAGAGAGGGAGGGAGG - Intergenic
933918010 2:87016241-87016263 AAAGAGGAAGAGTGGGAGGATGG + Intronic
934004985 2:87753673-87753695 AAAGAGGAAGAGTGGGAGGATGG - Intronic
935384189 2:102484245-102484267 AAGGAAAAAGTTTGGGAGGAGGG - Intronic
935480558 2:103582984-103583006 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
935731388 2:106066967-106066989 AAGAACAAAGAGTGGGAGGCAGG - Intronic
935767942 2:106387704-106387726 AAAGAGGAAGAGTGGGAGGATGG - Intergenic
936233567 2:110724931-110724953 AAGGAAGAACGGAGGGAGGAAGG + Intergenic
936291306 2:111225975-111225997 AAGGGGAACCAGTGGGAGGGAGG + Intergenic
936703705 2:115044301-115044323 AAGGAGAAACAGAGAGAGAAGGG + Intronic
936960037 2:118063258-118063280 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
937683565 2:124670172-124670194 AAAGAGAAAGAGAGGGAGGAAGG - Intronic
937934882 2:127235320-127235342 AAGGAGAAAGAGAGGAAGGAAGG + Intergenic
938155124 2:128930105-128930127 AAGCAGAGACTGTGGGAGGAAGG - Intergenic
939014434 2:136885889-136885911 AGGGATATGCAGTGGGAGCAGGG + Intronic
939039554 2:137171820-137171842 AAGGATGAAGAGAGGGAGGGAGG - Intronic
939131245 2:138237980-138238002 AAGGAAATACAGTTGGAAGAAGG - Intergenic
939156410 2:138529963-138529985 GAGGGTAAAGCGTGGGAGGAGGG - Intronic
939205203 2:139093240-139093262 AAGGTTATACGGTGAGAGGAAGG + Intergenic
939781567 2:146456760-146456782 GAGGATGAAGAGTGGAAGGAGGG - Intergenic
940714079 2:157198564-157198586 AAGGAAGAACAGAGGAAGGAAGG + Intergenic
940775595 2:157880163-157880185 AAAGATTAATAGTGGAAGGAAGG + Intronic
940879186 2:158929449-158929471 AAGGATGAGCAGGAGGAGGAAGG - Intergenic
941350305 2:164424348-164424370 AAGAAGGAACAGAGGGAGGAAGG + Intergenic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
941496933 2:166217092-166217114 AAGAATAAACAATGGGGGAAAGG + Intronic
941750135 2:169126683-169126705 AGAGATTAACAGTGGGAAGATGG + Intergenic
941794221 2:169582553-169582575 GAGTGTAGACAGTGGGAGGAGGG - Intergenic
941993632 2:171580663-171580685 GAGGATGGAGAGTGGGAGGAGGG - Intergenic
943519765 2:188933973-188933995 ATGGATAAACTGTGGGAGCTGGG - Intergenic
943549105 2:189316589-189316611 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
943923980 2:193747057-193747079 GAGGATAAAGGGTGGGAGGAGGG + Intergenic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
944143326 2:196480269-196480291 AAGTATAAACTGTGTGTGGAAGG - Intronic
944391288 2:199222415-199222437 GAGGATGAAGGGTGGGAGGAGGG - Intergenic
945013102 2:205485813-205485835 AAGGATAAAGAGAGGGTGGCTGG - Intronic
945121019 2:206457070-206457092 AAGGATAAACATGGGGAGAGAGG - Intronic
945200430 2:207275609-207275631 AATTATACACAGTGGAAGGAAGG - Intergenic
946725764 2:222659835-222659857 GAGAATAAAAAGGGGGAGGAAGG - Intergenic
946869330 2:224071783-224071805 AAGGCTGCACAGTGGGAAGAAGG - Intergenic
946938528 2:224746885-224746907 AAAAATAAACAGTGGAAAGAAGG - Intergenic
946971627 2:225099290-225099312 AAGGAAAGAAAGAGGGAGGAAGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948876110 2:240829986-240830008 AAGGAAAAACAGGGAGAGAATGG + Intergenic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1169406317 20:5324234-5324256 GAGGATAGAGGGTGGGAGGAGGG - Intergenic
1169750137 20:8983337-8983359 TAGGAAAAAGAGTTGGAGGATGG - Intergenic
1169895492 20:10501339-10501361 AAGGATAGACTGTGGGGGGAGGG - Intronic
1170319189 20:15075859-15075881 AAGGATAAAGGGTGGGGGAAAGG + Intronic
1170413848 20:16119637-16119659 AAGGATGGAGGGTGGGAGGAGGG + Intergenic
1170659284 20:18320758-18320780 AAGATTAATCAGTGGGAGGAGGG + Intergenic
1171231087 20:23485904-23485926 GAGGATAGAGGGTGGGAGGAAGG - Intergenic
1172032020 20:31989029-31989051 ATGGATTCACAGTGGGAGAATGG + Intronic
1172240749 20:33411132-33411154 TAGGAGAAAGAGTGGGTGGAGGG - Intronic
1172816350 20:37690179-37690201 AAGAAGATACAGTGGGAGAATGG - Intergenic
1172898262 20:38315796-38315818 AAGGAAGAAGAGTGGGAAGAAGG - Intronic
1173366627 20:42391633-42391655 AAGCCTAAAGAGCGGGAGGAAGG + Intronic
1173618273 20:44416910-44416932 AAGGAGAAAAGGTGGGAGGAAGG - Intronic
1173718125 20:45229457-45229479 CTGGATACACAGTGGGAAGAGGG + Intergenic
1174393292 20:50231398-50231420 CAGGCAGAACAGTGGGAGGAAGG + Intergenic
1174744427 20:53047448-53047470 AAGGAAAAGCAGTGGAAGGCAGG + Intronic
1174860390 20:54085983-54086005 AAGGCTACACAGTGAGAAGATGG - Intergenic
1175319343 20:58074399-58074421 AAGCAGAAAGAGAGGGAGGAGGG + Intergenic
1175663131 20:60834832-60834854 GAGGAAAAACAGTTGCAGGAGGG - Intergenic
1175904958 20:62375203-62375225 AAGGCTGAAAGGTGGGAGGATGG + Intergenic
1175906964 20:62385510-62385532 AGGGTAGAACAGTGGGAGGAGGG + Intergenic
1176674490 21:9765558-9765580 AATGATAGACAATGGAAGGAAGG + Intergenic
1176674497 21:9765650-9765672 AATGATAGACAATGGAAGGAAGG + Intergenic
1177302367 21:19264801-19264823 ATGGATAAACTGTGGCAGAATGG - Intergenic
1177306895 21:19330264-19330286 AAGGATAACCAAAGAGAGGAGGG - Intergenic
1177493360 21:21856918-21856940 GAGGACAGAGAGTGGGAGGAAGG + Intergenic
1178016745 21:28355542-28355564 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1178142732 21:29702143-29702165 GAGGACAAAGGGTGGGAGGAGGG + Intronic
1178259472 21:31085571-31085593 AGGGATAGACAGAGGGAGGGAGG + Intergenic
1179244793 21:39623282-39623304 AAAGAGAAACAGAGGAAGGAAGG - Intronic
1179372749 21:40821861-40821883 AAGGGTGGAAAGTGGGAGGAGGG + Intronic
1179436437 21:41365371-41365393 AAGGGTAGAGGGTGGGAGGAAGG - Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179714907 21:43281619-43281641 CAGGATGAACATCGGGAGGAGGG - Intergenic
1180577313 22:16790551-16790573 GAGGCTACAGAGTGGGAGGAAGG + Intronic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1181413982 22:22746343-22746365 AAGGAAAGGCAGAGGGAGGAGGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181866016 22:25855982-25856004 GAGGGTAAAGAGTGGGAGGAGGG - Intronic
1182126069 22:27816756-27816778 AAGGATCAGAAGAGGGAGGAGGG - Intergenic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183921863 22:41176291-41176313 CAGGATCAACAATGGGAGGCAGG - Exonic
1184195726 22:42926493-42926515 GAAGAAAAACAGTGGGAGGAAGG + Intronic
1184888170 22:47360187-47360209 AAGGATAAATAGGGGGAGTGTGG - Intergenic
949710246 3:6862885-6862907 ACGGAGAAAAAATGGGAGGAAGG + Intronic
949712434 3:6887114-6887136 CAGTTTAAACAGTGGGAGAAAGG - Intronic
949867188 3:8555650-8555672 TAGTATAAAAAGTGGGAGAAAGG - Intronic
950069115 3:10137793-10137815 AGGGATTAACAGTGGAAGCAGGG + Intergenic
950092900 3:10309442-10309464 AAGGATAAACAGTGTGAAAAAGG - Intronic
950323683 3:12083519-12083541 AAGGAGAAACTTTGGGAGGAAGG - Intronic
950853503 3:16084644-16084666 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
951021929 3:17790571-17790593 AAAGATATACAGTGGGTGAATGG - Intronic
951433593 3:22636688-22636710 GAGGATAGAGGGTGGGAGGAGGG - Intergenic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
951519330 3:23596806-23596828 AAGAATAAAGAGGGAGAGGAGGG - Intergenic
951706377 3:25547784-25547806 GAGGATAGACGGTGGGTGGATGG + Intronic
951972974 3:28469057-28469079 AAAGTTAAAAAGAGGGAGGAAGG + Intronic
953215701 3:40915764-40915786 AAGGCTAAACAATGTGAGTAAGG - Intergenic
953935551 3:47038774-47038796 TAGGATAAAAAGTGGAAGTAAGG + Intronic
954495477 3:50955680-50955702 GAGGGTGAAGAGTGGGAGGAAGG + Intronic
954861160 3:53691587-53691609 AAGGAGATACAGTGAAAGGAAGG + Intronic
955525511 3:59815732-59815754 AAGGGAAAAGAGTGGGAGGGGGG + Intronic
955534719 3:59910645-59910667 AAGAAAAAATAGGGGGAGGAAGG + Intronic
955901857 3:63764402-63764424 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901861 3:63764421-63764443 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901865 3:63764440-63764462 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955901871 3:63764474-63764496 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
955956763 3:64298127-64298149 GAGGGTAAAGGGTGGGAGGAGGG - Intronic
956296037 3:67714610-67714632 AAGCAAAAAAAGTGGGAGGCAGG + Intergenic
956447547 3:69340312-69340334 AAGGATAGAGGGTGGGAGGAGGG - Intronic
956665412 3:71637534-71637556 AAGGAGAAAGAGGGGGAGGAGGG + Intergenic
956690537 3:71874240-71874262 AAGGATAAATAGGTGGAGCACGG + Intergenic
956929521 3:74027255-74027277 ATAGATAAAGACTGGGAGGAAGG - Intergenic
957167991 3:76699803-76699825 AAGAGGAAACAGGGGGAGGAAGG - Intronic
957243054 3:77683912-77683934 AACGATCAACAGATGGAGGAAGG + Intergenic
957311358 3:78523573-78523595 AAGGATAAAAAGTGGTGAGATGG + Intergenic
957593784 3:82233937-82233959 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
958022167 3:88011117-88011139 AAGCAGAAACTGTGGGAGGCAGG + Intergenic
958595608 3:96217748-96217770 CAGGATTAACAGTGGCAGCATGG + Intergenic
959073041 3:101721099-101721121 TAGGATGAACGGTGGGAGGTAGG + Intergenic
959111774 3:102131269-102131291 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
959112635 3:102140275-102140297 AAGGAGAAAGAGAGGGAGGGAGG - Intronic
959312107 3:104751836-104751858 AATGATGAAAAGTGAGAGGATGG + Intergenic
959416444 3:106080987-106081009 GAGGATAGAGAGTGGGAGGAGGG - Intergenic
959734043 3:109637363-109637385 GAGGCTGAAGAGTGGGAGGAGGG - Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
960015191 3:112879411-112879433 GAGGATGAAAAGTGAGAGGAGGG - Intergenic
960147906 3:114222469-114222491 AAGTATGAACAGTGTTAGGAGGG - Intergenic
960325168 3:116286578-116286600 AGGGATAAAAAGCTGGAGGAGGG - Intronic
961350072 3:126294273-126294295 AAGGAAAAACAGTGAGTTGATGG - Intergenic
962144817 3:132829724-132829746 AAGGATAAATAGTTGGAAAATGG - Intergenic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
962386135 3:134934063-134934085 AAAGATAAAGAGTGGGTGGGAGG - Intronic
962626845 3:137234197-137234219 AAGGCTTAACTGGGGGAGGATGG - Intergenic
962681541 3:137805453-137805475 GAGGATGGAGAGTGGGAGGAGGG + Intergenic
963444246 3:145383345-145383367 AAGGAGAAAAGGAGGGAGGAAGG + Intergenic
963632097 3:147746242-147746264 AAGGGTGGAGAGTGGGAGGAGGG - Intergenic
963952130 3:151214488-151214510 AAGGAAGAACAGAGGGAGGGAGG - Intronic
964108105 3:153060453-153060475 AAGAAGAAAGAGAGGGAGGAAGG + Intergenic
964643763 3:158936634-158936656 AAGCATTAACACTCGGAGGAGGG + Intergenic
964776928 3:160289301-160289323 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
965084629 3:164079018-164079040 GATGGTAGACAGTGGGAGGATGG + Intergenic
965087277 3:164114652-164114674 GATTATAAACAGTGGGAGGTAGG + Intergenic
965547117 3:169927262-169927284 AAAGATAAAAAGAGGCAGGATGG - Intronic
965635201 3:170773625-170773647 GAGGATAAGAATTGGGAGGAAGG + Intronic
965655928 3:170984869-170984891 AAAGACATACTGTGGGAGGATGG - Intergenic
966140728 3:176752746-176752768 AAGGAGAGAGAGAGGGAGGAAGG + Intergenic
966263692 3:178011906-178011928 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
967453077 3:189649472-189649494 AAGGATAGAGGGTGAGAGGAAGG + Intronic
968092492 3:195907899-195907921 AAGGATGATTAGTGGGCGGAAGG - Intronic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
968695658 4:2024957-2024979 CAGGATAAACAGTGGCAGCATGG + Intronic
969117569 4:4881209-4881231 CAGGACAACCAGTGGTAGGAGGG - Intergenic
970792649 4:19876783-19876805 AAGGAAGAAAAGTGGGAGGGAGG + Intergenic
971034173 4:22675142-22675164 AAAGAGAAAGAGAGGGAGGAAGG - Intergenic
971493003 4:27234229-27234251 GAAGAGAAAGAGTGGGAGGAAGG - Intergenic
971620174 4:28845626-28845648 GAGGGTAGAAAGTGGGAGGAGGG - Intergenic
971838324 4:31798969-31798991 AAAGTTAAAAAGTGGGAAGATGG - Intergenic
971927476 4:33031620-33031642 AAGGCTAATAAGTGGTAGGATGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972377099 4:38482559-38482581 AAAAAAAAACAGTGGGAGAAAGG + Intergenic
972600128 4:40564882-40564904 GAGGATCCTCAGTGGGAGGAAGG + Intronic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
973102416 4:46289548-46289570 AAGGGTAGAGGGTGGGAGGAGGG + Intronic
973723242 4:53746481-53746503 TAGGAAAAAAAGTGGGAGGCAGG + Intronic
973739578 4:53906433-53906455 AAAGATAAGCTGTGGGAGAAAGG - Intronic
974467237 4:62272924-62272946 ATGGATGAGAAGTGGGAGGAAGG - Intergenic
974570176 4:63635629-63635651 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
974660251 4:64879174-64879196 AAGGAGAGATAGAGGGAGGAGGG - Intergenic
975570851 4:75816261-75816283 TAGGTTAAAAAGTGGGGGGAGGG - Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976336322 4:83892161-83892183 AGGAATAAAGAGAGGGAGGAAGG - Intergenic
976494454 4:85711242-85711264 GAGGATAAAGGGTGGAAGGAGGG + Intronic
977226837 4:94402454-94402476 AAGGATGGAGGGTGGGAGGAGGG - Intergenic
977329473 4:95619346-95619368 GAGGATAGAGGGTGGGAGGAGGG + Intergenic
977359399 4:95983657-95983679 AAGAGGAAACAGTGGCAGGAAGG + Intergenic
977558315 4:98506868-98506890 AAGGAAAAAAGCTGGGAGGAGGG + Intronic
977709286 4:100106452-100106474 AGGGACAAACACTGGGATGAGGG + Intergenic
977854611 4:101874961-101874983 AAAGATAGAAAGTGAGAGGAAGG + Intronic
978329130 4:107592832-107592854 AAAGATAAACTGTTGGAGAAAGG + Intronic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
979033793 4:115685713-115685735 GAGGATAGAGAGTGTGAGGAAGG - Intergenic
979616319 4:122746847-122746869 GAGGCTAAACAGTGTGAGGCAGG - Intergenic
979939221 4:126738924-126738946 TGGGATAGACAGTGAGAGGAAGG - Intergenic
980394094 4:132186162-132186184 AGGGAAAAAAAGAGGGAGGAAGG + Intergenic
980579150 4:134726981-134727003 AAATATAAACTGTGGGAGAAAGG + Intergenic
980581769 4:134763471-134763493 AAGAGCAAAAAGTGGGAGGAAGG - Intergenic
980710341 4:136557996-136558018 AAGAAAAAACATTGTGAGGAAGG + Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
980967714 4:139539179-139539201 AAGGGAACACAGTGGAAGGAAGG - Intronic
981289603 4:143058925-143058947 GAGGATAGAGATTGGGAGGAGGG - Intergenic
982475873 4:155849945-155849967 AAGAGAAAATAGTGGGAGGAAGG - Intronic
982706862 4:158719888-158719910 AAGGATACACAGCGAGATGACGG + Intronic
982912849 4:161166318-161166340 GAGGATGGAGAGTGGGAGGAGGG + Intergenic
982921578 4:161280509-161280531 AAGGATAGAGAGTGGGAAGCAGG - Intergenic
983658767 4:170110753-170110775 AAAGAAAAAAAGAGGGAGGAAGG - Intergenic
983753218 4:171302132-171302154 GAGGATGGAGAGTGGGAGGAGGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985804227 5:2029382-2029404 AAGAATAAAAAGTGGGTGGGGGG - Intergenic
986070632 5:4279058-4279080 AAGGAGAAAAAGTGAGAGGGGGG - Intergenic
986142462 5:5043824-5043846 GAGGATGGAAAGTGGGAGGAGGG - Intergenic
986481836 5:8197282-8197304 GAGGATGGAGAGTGGGAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987730887 5:21771059-21771081 GAGGACAGAGAGTGGGAGGAGGG + Intronic
988337405 5:29923975-29923997 AAGGATGAAGGGTGGGAGGAGGG + Intergenic
988424850 5:31052018-31052040 AAGGAGAAAAAGTGTGAGGTGGG - Intergenic
989017344 5:36954208-36954230 AAGGGTAGAAAGTGAGAGGATGG + Intronic
989108202 5:37883126-37883148 TAGGATGAAGAGAGGGAGGAAGG + Intergenic
989316960 5:40092565-40092587 AAGAGAAAATAGTGGGAGGAAGG - Intergenic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
990317858 5:54601077-54601099 ATGGACAGACAGAGGGAGGACGG - Intergenic
991034518 5:62114719-62114741 AAGGATAAACAGGGGTTGGCCGG + Intergenic
992141404 5:73800817-73800839 AAGGAAAAACATTGGGAAAAGGG + Intronic
992154772 5:73944462-73944484 AAGGATAAAGAGCAGGAGTAGGG + Intergenic
992520159 5:77542273-77542295 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
992757277 5:79919726-79919748 GAGGATGGAGAGTGGGAGGAGGG + Intergenic
993393199 5:87347372-87347394 AAGAATAAACAATGACAGGATGG - Intronic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
994049643 5:95348033-95348055 TAGGGTAAACATTGGGAGAATGG + Intergenic
994277883 5:97861022-97861044 AAGGATAAAGAGTGGGAGGAGGG + Intergenic
994557842 5:101327375-101327397 AAGGTGAAAGGGTGGGAGGAGGG + Intergenic
994564877 5:101430884-101430906 AAGGATGGAAGGTGGGAGGAAGG + Intergenic
994573210 5:101540037-101540059 AAGGGTGAAGAGTGAGAGGAGGG + Intergenic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
994932088 5:106202641-106202663 AATTATAAAAAGTGGGAAGATGG + Intergenic
995876276 5:116793406-116793428 AAAGATAAACAATGGGACAATGG + Intergenic
995894890 5:117001402-117001424 AAGGATGGAGGGTGGGAGGAGGG - Intergenic
995935103 5:117501470-117501492 AAGGAAAACCAGTGGTAGGCTGG - Intergenic
996046523 5:118879802-118879824 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
996412997 5:123179399-123179421 ATGGATAAATATTTGGAGGAGGG + Intronic
997181735 5:131836041-131836063 AAGGGTGGAGAGTGGGAGGAGGG - Intronic
997900226 5:137756458-137756480 AAGGATGGAGGGTGGGAGGAGGG + Intergenic
998191849 5:140031964-140031986 AAGGAGAAACATTAGGAGAAAGG + Intronic
998454277 5:142258920-142258942 AATGAAAAACAGTGGAAGGAAGG - Intergenic
998714467 5:144867326-144867348 AAGAAGGAACAGTGGGAGGTAGG - Intergenic
998936193 5:147233290-147233312 AAGAATATACAGTGGGGGGCGGG - Intergenic
999700337 5:154221814-154221836 CAGCATAAAGAGTGGCAGGAAGG - Intronic
999895923 5:156033380-156033402 AAGGAGAGAGGGTGGGAGGAGGG - Intronic
1000079639 5:157832765-157832787 TTGGATATTCAGTGGGAGGAAGG - Intronic
1000114124 5:158137115-158137137 AAGGAAAAAGAGAGGAAGGAGGG - Intergenic
1000216596 5:159163460-159163482 AAGTGGAAACAGTGGGAAGAGGG - Intronic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000452620 5:161408753-161408775 AAGGATAAAGAGAGAGATGAGGG + Intronic
1000495357 5:161976243-161976265 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1000591273 5:163160628-163160650 AAGGATGAACAGGTGGAGCATGG + Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001205589 5:169759819-169759841 AGGGATTCAGAGTGGGAGGAGGG + Intronic
1001461034 5:171914657-171914679 AAGGCTAAATTGTGGGAGTAAGG + Intronic
1001569920 5:172723874-172723896 AAGGAGAGAAAGAGGGAGGAAGG + Intergenic
1002067620 5:176660057-176660079 ATGGATGAAGAGTGGGTGGATGG - Intergenic
1002327700 5:178420570-178420592 AAGGAGAAAGAGTGGGAGAGGGG - Intronic
1002822963 6:745436-745458 GAGGGTAAAGGGTGGGAGGAGGG + Intergenic
1003356285 6:5375037-5375059 AATGATGAACAGTGATAGGAAGG - Intronic
1003514688 6:6808119-6808141 AAAGATAAAGGGTGGCAGGAGGG - Intergenic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1005357270 6:24996560-24996582 AAGCAGAAACAGTGGTGGGAGGG - Intronic
1005569678 6:27132781-27132803 AAGGAAAAACAGCGTGAGCAGGG + Intergenic
1006024871 6:31140252-31140274 AGGGATAAACAGTGGGAGCAAGG - Intergenic
1006245221 6:32728033-32728055 AGGGAGAAAGAGAGGGAGGATGG - Intergenic
1006557877 6:34884430-34884452 AAGGATGAAGGGTGGCAGGAGGG + Intronic
1006735067 6:36267710-36267732 AAGGGTAAGCAGGCGGAGGAGGG - Intronic
1006979014 6:38131644-38131666 AGGGGACAACAGTGGGAGGAAGG - Intronic
1007027311 6:38589516-38589538 TTGGATAAAGTGTGGGAGGATGG - Intronic
1007144695 6:39616665-39616687 AAGGATTTTCAGTGGGAGGCAGG - Intronic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007358701 6:41340667-41340689 AAGTATAAAAATTGGGAGTAGGG - Intronic
1007767033 6:44166731-44166753 AATAAGAAAGAGTGGGAGGAGGG - Intronic
1007989905 6:46244304-46244326 AAGGAAAGAAAGAGGGAGGAAGG - Intronic
1008614646 6:53214721-53214743 AGGGGAGAACAGTGGGAGGAGGG - Intergenic
1009063849 6:58432313-58432335 CAGGATAAAAAGTAGAAGGAAGG - Intergenic
1009259354 6:61464264-61464286 CAGGATAAACACTAGAAGGAAGG + Intergenic
1009330646 6:62415519-62415541 AAGGGTAGACGGTGAGAGGAGGG + Intergenic
1009777994 6:68230750-68230772 AAAGAAAGAAAGTGGGAGGAAGG + Intergenic
1010178756 6:73059410-73059432 GAGGATGGAAAGTGGGAGGAGGG + Intronic
1010330356 6:74616456-74616478 AAGGATGGAGAGTGGGAGGATGG - Intergenic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1010659025 6:78547313-78547335 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1010692429 6:78926034-78926056 AAGGATGGAGGGTGGGAGGAGGG + Intronic
1010704334 6:79089806-79089828 AAGGAAAAAGAGAGGGAGGGAGG - Intergenic
1012247744 6:96944866-96944888 AAGAATAAACAGTCTTAGGAAGG + Intronic
1012734301 6:102919649-102919671 AAAGAAAAAGAGAGGGAGGAGGG + Intergenic
1013214880 6:108018270-108018292 AAGGATAAGAAATGGAAGGACGG + Intergenic
1013689759 6:112627552-112627574 AAGAATAAAGAATGGGAGGCTGG - Intergenic
1013862353 6:114650953-114650975 TAGGACAAAGAGTGTGAGGATGG + Intergenic
1013881059 6:114901462-114901484 AAGGTTGGAGAGTGGGAGGAGGG - Intergenic
1014103867 6:117541510-117541532 AAGGAGGAACAGAGGTAGGAGGG + Intronic
1014118676 6:117697351-117697373 AAAGACATACAGTGGGCGGATGG + Intronic
1015114087 6:129627616-129627638 AAGGAAAAATAGAGAGAGGAAGG + Intronic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1015536432 6:134271754-134271776 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015771204 6:136769927-136769949 AAAAAGAGACAGTGGGAGGAAGG + Intronic
1016054025 6:139559708-139559730 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1016894185 6:149036407-149036429 AAGGATTATCAGTGGAAGGCAGG - Intronic
1016985097 6:149889153-149889175 AGGAAGAAACAGTGGGAGGTGGG + Intronic
1017026727 6:150187444-150187466 AAGGGTAGAGGGTGGGAGGAGGG - Intronic
1017318824 6:153064327-153064349 AAAGTTAAAAAGTGGGGGGATGG + Intronic
1017604789 6:156122439-156122461 AAGGATAAACTATAGGATGATGG - Intergenic
1017734980 6:157354609-157354631 GAGGCTGAACAGTGGGAGGATGG - Intergenic
1017912803 6:158808758-158808780 CAGGATAAATAGAGGGAAGAAGG - Intronic
1018128782 6:160707845-160707867 AAAGAGGAAGAGTGGGAGGATGG - Intronic
1018305739 6:162453310-162453332 AAGGAAAAAGAGAGAGAGGAGGG - Intronic
1019066829 6:169309364-169309386 AATGATAGACACTGGGAGGAGGG + Intergenic
1019083925 6:169456644-169456666 AATCATCAACTGTGGGAGGAGGG + Intergenic
1019320789 7:414403-414425 AAGGAGGAAGAGGGGGAGGAGGG - Intergenic
1019326855 7:442732-442754 AAGGATAGATGGTGGAAGGACGG + Intergenic
1020986333 7:15139505-15139527 AAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021327973 7:19297752-19297774 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1021352287 7:19609928-19609950 AAGAAGGAACAGAGGGAGGAAGG - Intergenic
1021383243 7:19994654-19994676 GAGGATGAAGAGTTGGAGGAGGG - Intergenic
1021494873 7:21263400-21263422 AGGAATAAACATTGGAAGGAGGG + Intergenic
1021518685 7:21516483-21516505 AAGCAGAAATAGTGGAAGGAAGG + Intergenic
1021921028 7:25485049-25485071 AGGGAGAAAGAGTGGGAGAAAGG + Intergenic
1022177638 7:27887124-27887146 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1022552110 7:31250841-31250863 ATGGATATACAGTGAGAGTAGGG + Intergenic
1022951390 7:35341590-35341612 AAGGTTAAACTTAGGGAGGAAGG + Intergenic
1023044634 7:36200123-36200145 GAGGATGGAGAGTGGGAGGAGGG - Intronic
1023229604 7:38012815-38012837 AAGGGTGAAGAGTGGGAAGAGGG - Intronic
1023785265 7:43701248-43701270 GAGGATGGAGAGTGGGAGGAGGG - Intronic
1023957406 7:44897896-44897918 AAGTATTAACAGTTGGAGAATGG + Intergenic
1024423322 7:49196199-49196221 GAGGGTAGAGAGTGGGAGGAAGG - Intergenic
1025964882 7:66259898-66259920 AAGGATAAATAGGGGGAACACGG - Intronic
1026113568 7:67477554-67477576 ACAGATAAACAGTGGGGTGAGGG + Intergenic
1026123240 7:67556097-67556119 AAGGAGAAAGGGAGGGAGGAAGG - Intergenic
1026427957 7:70315506-70315528 GAGCATGAACAGTGGGAAGAGGG - Intronic
1026844623 7:73691437-73691459 AAGGATCAGCACTAGGAGGAGGG - Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1027833948 7:83217708-83217730 AAGGGTAGAGGGTGGGAGGAGGG - Intergenic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028728132 7:94112675-94112697 AAGGAGAAAGAGAGGGAGGGAGG + Intergenic
1028911881 7:96216745-96216767 GAGGGTAAAGGGTGGGAGGAGGG + Intronic
1029414672 7:100435558-100435580 AAGGTTACACTTTGGGAGGAAGG + Intronic
1029891219 7:103932386-103932408 GAGGATGGAGAGTGGGAGGAGGG + Intronic
1030560999 7:111085966-111085988 GAGGGTTAAGAGTGGGAGGAGGG + Intronic
1030611743 7:111697463-111697485 AAGGATAAATAATGGGGGTATGG - Intergenic
1031030639 7:116730569-116730591 TAGGATGAAAATTGGGAGGAAGG + Intronic
1031046949 7:116901510-116901532 GAGGATGAAGGGTGGGAGGAGGG + Intronic
1031289672 7:119917209-119917231 GAGGGTAAAGAGTGGGAGGAGGG + Intergenic
1031464941 7:122097514-122097536 AAGGGTAAAAGGTGGGAGGAGGG - Intronic
1031574849 7:123402952-123402974 AAAGAAAATCAGTGAGAGGAAGG + Intergenic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031663860 7:124460864-124460886 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1031868051 7:127061610-127061632 AAGCATCAGCAGGGGGAGGAAGG - Intronic
1031871257 7:127091727-127091749 AGGGATGACCAGTGGGAGGAGGG - Intronic
1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG + Intergenic
1031945472 7:127835157-127835179 AAGAATAATTAGTGGGGGGAAGG - Intronic
1031995269 7:128226491-128226513 AAGGATGGACAATAGGAGGATGG - Intergenic
1031995274 7:128226514-128226536 AAGGATGGACAATAGGAGGATGG - Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033530521 7:142258233-142258255 ATGGATAAACAGTGACATGAAGG - Intergenic
1033595227 7:142854552-142854574 AAGGAAAAGCAGGGGGTGGAGGG - Intergenic
1033954878 7:146834490-146834512 AAGGAAAGACAGATGGAGGATGG + Intronic
1034886609 7:154803416-154803438 AAGAATAAACGGAGGGAGAAAGG - Intronic
1035439579 7:158885127-158885149 AGTGATAAACAGTGGGCAGAGGG - Intronic
1035988108 8:4456909-4456931 CAGGATAAACAGTTGGTGGGTGG - Intronic
1036193308 8:6691489-6691511 GAGGGTAAAGAGTGGGAGGAGGG - Intergenic
1037273519 8:17155736-17155758 AAGAATAAATAGTTGGTGGAAGG + Intergenic
1037373028 8:18200534-18200556 AAGGGTAAAGGGTGGGAGGATGG + Intronic
1037476938 8:19267195-19267217 AAGGGAGAAGAGTGGGAGGAGGG + Intergenic
1037496990 8:19450061-19450083 AAGAAGAAAGAGGGGGAGGAGGG + Intronic
1037703365 8:21295442-21295464 AAGGAGGAAGAGTGGGGGGAGGG - Intergenic
1037871621 8:22502824-22502846 AATCATTAACAGTGGGAGGTTGG + Intronic
1037959921 8:23089211-23089233 CAGGGTAGAAAGTGGGAGGAGGG + Intronic
1038323669 8:26553369-26553391 AAGGATGGAGGGTGGGAGGAGGG - Intronic
1038461285 8:27719379-27719401 GAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1038779477 8:30557762-30557784 AAGGAAGAGCAGTGGGAGGCGGG + Intronic
1038852938 8:31297711-31297733 AAGGATGGAGGGTGGGAGGAGGG + Intergenic
1038958063 8:32488745-32488767 ATGGAGAGACAGTGGGTGGAGGG + Intronic
1039879529 8:41615926-41615948 AATGATAAACAGTGAGTGGCTGG - Intronic
1040112726 8:43576990-43577012 AAGGATAAAAAGTAGAAAGAAGG + Intergenic
1040482271 8:47836914-47836936 CAGCCTAAACAGTGGGATGATGG - Intronic
1041010968 8:53542911-53542933 GAGGATAGAGGGTGGGAGGAGGG - Intergenic
1041711228 8:60896333-60896355 GAGGCTGAACAGTGGGAGTATGG - Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041755173 8:61305699-61305721 GAGGGTAGAGAGTGGGAGGAGGG - Intronic
1042537739 8:69875725-69875747 AAAGAAAAAGAGAGGGAGGAAGG + Intergenic
1042966033 8:74352982-74353004 GAGGAAAAACAGTGTAAGGAGGG - Intronic
1043215925 8:77587900-77587922 AAGGATGAAGAGTAGGATGATGG - Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043540376 8:81255662-81255684 AAGGAAAAACTTGGGGAGGAAGG + Intergenic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044112541 8:88293247-88293269 AAGAGGAAACAGTGGAAGGAGGG - Intronic
1044242782 8:89906421-89906443 GAGGATGAAGGGTGGGAGGAGGG - Intronic
1044351264 8:91169252-91169274 GAGGGTAGAAAGTGGGAGGAGGG + Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1045591391 8:103602448-103602470 GAGGGTGAAGAGTGGGAGGAGGG - Intronic
1045884594 8:107080346-107080368 AAGGATATGTAATGGGAGGAGGG + Intergenic
1046111355 8:109729788-109729810 AAGGAGGAAGAGGGGGAGGAGGG + Intergenic
1046188902 8:110763491-110763513 GAGGGTAGAAAGTGGGAGGAGGG + Intergenic
1046282650 8:112053860-112053882 GAGGGTAGAGAGTGGGAGGAGGG - Intergenic
1046388830 8:113541008-113541030 AAGGATAGGGAGTGGGAGGTTGG - Intergenic
1046634801 8:116662605-116662627 GAGGATAAACTGTGGGTGAAGGG - Intronic
1047214297 8:122864203-122864225 AGGGACAGGCAGTGGGAGGAGGG + Intronic
1047319361 8:123765068-123765090 AAGGGTAAAAACTGGGAGGTGGG + Intergenic
1047525033 8:125625897-125625919 AAGGATAAAAGGAGGGAGGAGGG - Intergenic
1047790826 8:128202025-128202047 AAGGAAAATATGTGGGAGGAAGG - Intergenic
1048436083 8:134419164-134419186 GAGGATGGACAGTGGGAGGAGGG + Intergenic
1048515439 8:135105115-135105137 AAGGATAAATACTTGGGGGATGG - Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1049122069 8:140747772-140747794 AAGGAGGAAGAGGGGGAGGAAGG + Intronic
1049240376 8:141534917-141534939 GAGGAGGACCAGTGGGAGGAGGG - Intergenic
1050646241 9:7722784-7722806 GAGGATAAAGGGTGGGAGGAGGG - Intergenic
1050718446 9:8557064-8557086 AAGGAGGACCAGTGAGAGGAAGG + Intronic
1050932886 9:11351857-11351879 AATGATTACCTGTGGGAGGACGG + Intergenic
1051494609 9:17705800-17705822 GAGGGTAGAGAGTGGGAGGAGGG + Intronic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1052281936 9:26742855-26742877 AAGAATAAAGAATGGGAGGAAGG + Intergenic
1052316631 9:27122498-27122520 AGGGATTAAAAGTGGGAAGATGG + Intronic
1054362764 9:64193156-64193178 CAGGATAAACACTAGAAGGAAGG + Intergenic
1054556731 9:66664714-66664736 AAGTATCCACAGTGGCAGGATGG - Intergenic
1055372851 9:75619349-75619371 GAGGGTAAAGGGTGGGAGGAGGG - Intergenic
1055722240 9:79188292-79188314 AAGGAGAAAGAGAGGGAAGAGGG - Intergenic
1056130137 9:83576584-83576606 GAGGATAAAGGGTTGGAGGAGGG - Intergenic
1056456754 9:86767869-86767891 AAGGACAAAGAGAGGGAAGAGGG - Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1057047858 9:91899627-91899649 AAGGAGAAAGATGGGGAGGAGGG + Intronic
1057272272 9:93657904-93657926 AGGGTGAGACAGTGGGAGGATGG + Intronic
1057983616 9:99687232-99687254 GGGGATAGAAAGTGGGAGGAGGG + Intergenic
1058108058 9:100997456-100997478 AAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1058174356 9:101720848-101720870 GAGGGTGAAGAGTGGGAGGAGGG + Intronic
1058850765 9:109010125-109010147 GAGGCTAAAAAATGGGAGGATGG - Intronic
1059172048 9:112134593-112134615 GAGGACAAATAGAGGGAGGAGGG + Intronic
1059363428 9:113766276-113766298 AAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1059582464 9:115566695-115566717 AAGGAAAAAGAGAGAGAGGAAGG - Intergenic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1059653717 9:116338190-116338212 AAGAATAAATGGAGGGAGGAGGG - Intronic
1059807411 9:117817715-117817737 TAGAAGAAAGAGTGGGAGGAGGG - Intergenic
1060418836 9:123452995-123453017 TAGGAGCAAAAGTGGGAGGAAGG + Intronic
1061141479 9:128770110-128770132 AGAAAGAAACAGTGGGAGGATGG - Intronic
1061218557 9:129235841-129235863 AAGGACACACAGTGGGTGCAGGG + Intergenic
1061536761 9:131255115-131255137 AAGGGTCAGCAGTGGCAGGAAGG + Intergenic
1062227091 9:135458479-135458501 AAGGGTAGAGGGTGGGAGGAAGG - Intergenic
1185611473 X:1395881-1395903 ATGGATAATGAGTGGGTGGATGG + Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1185921668 X:4100001-4100023 GAGGATGAAGGGTGGGAGGAGGG - Intergenic
1186078776 X:5908064-5908086 GAGGAGAGACAGTGGAAGGAGGG + Intronic
1186135111 X:6511068-6511090 GAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186490724 X:9970256-9970278 AAGGAGGAACAGAGGGAGGGGGG - Intergenic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1187213983 X:17256926-17256948 AAACATAAAATGTGGGAGGAGGG + Intergenic
1187440588 X:19314579-19314601 AAGGAAAAATATGGGGAGGAAGG - Intergenic
1187770461 X:22690250-22690272 GAGGAGAAACAGTGGGGTGAGGG + Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188285304 X:28319544-28319566 AAGGATAAACAGAGGTTGGTTGG + Intergenic
1188579400 X:31691146-31691168 AAACATAAAATGTGGGAGGAGGG + Intronic
1188635601 X:32426952-32426974 GAGGATAGAGAATGGGAGGAAGG + Intronic
1188666452 X:32827575-32827597 AAGAGTAAAAGGTGGGAGGAGGG - Intronic
1188755986 X:33964333-33964355 GAGGGTGAAGAGTGGGAGGAGGG - Intergenic
1189224183 X:39398712-39398734 AAGGAAAAAAAGAGGGAGGGAGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189435025 X:40984969-40984991 GAGGATGGAGAGTGGGAGGAGGG - Intergenic
1190636297 X:52437317-52437339 AAGCACAGACAGTGGGGGGAGGG + Intergenic
1190636307 X:52437423-52437445 AATCATAAACAGAGGGAGGCTGG + Intergenic
1190644262 X:52510259-52510281 AAGGATGGAGAGGGGGAGGAAGG - Intergenic
1190809605 X:53870506-53870528 GAGGATGGAGAGTGGGAGGAGGG - Intergenic
1191263421 X:58355068-58355090 CAGGATAAAAAGTAGGTGGAAGG + Intergenic
1191269320 X:58442761-58442783 AAGGATAAACACTAGAAGGTAGG - Intergenic
1191678816 X:63819845-63819867 CAGCATGAACGGTGGGAGGAGGG - Intergenic
1192675826 X:73195251-73195273 GAGGATAGAGAGTGGGAAGAAGG - Intergenic
1192866432 X:75137871-75137893 GAGGGTAGACAATGGGAGGAGGG + Intronic
1193292530 X:79792376-79792398 AAGAGGAAAAAGTGGGAGGATGG - Intergenic
1193386477 X:80878441-80878463 AAGGATGAATGGTGGGAGGAGGG - Intergenic
1193552760 X:82918633-82918655 GATGGTGAACAGTGGGAGGAGGG - Intergenic
1193637183 X:83965978-83966000 GAGGATAGAGGGTGGGAGGAGGG + Intergenic
1193880925 X:86919970-86919992 AAGCATAATCAGTGGAAGGGGGG - Intergenic
1194027779 X:88775323-88775345 AAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1194044843 X:88989787-88989809 AAGAGCAAATAGTGGGAGGAAGG - Intergenic
1194280261 X:91943114-91943136 GAGGATAAACAGTTGGAACATGG + Intronic
1194914382 X:99686862-99686884 AAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1195375164 X:104219512-104219534 AAGGATAGAGGGAGGGAGGAAGG + Intergenic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196540752 X:116904080-116904102 GAGGTTGAAAAGTGGGAGGAGGG + Intergenic
1196573967 X:117296935-117296957 GAGAATGAAGAGTGGGAGGAGGG - Intergenic
1197254137 X:124244813-124244835 AAGTATAAACACTGGAAGAAGGG - Intronic
1197404235 X:126029916-126029938 ATTGGTAATCAGTGGGAGGATGG + Intergenic
1197922209 X:131607366-131607388 AAGAATCAACAGTAGGAGCAGGG - Intergenic
1198272450 X:135067355-135067377 CAGGATTAACAGTGGCAGCATGG - Intergenic
1198483650 X:137064862-137064884 AAGGTTAAGCAGTAGGAAGAGGG - Intergenic
1198843415 X:140882922-140882944 AAGGGTAGAGAGTGGGAGGAGGG + Intergenic
1198954034 X:142107191-142107213 AATGGTAAAGGGTGGGAGGAGGG + Intergenic
1198957915 X:142152061-142152083 AAGGATGGAGGGTGGGAGGAGGG - Intergenic
1199031291 X:143003622-143003644 AAGGATATACAGTGAAAGCAAGG - Intergenic
1199321172 X:146440990-146441012 AAGAGAAAACAGGGGGAGGAAGG + Intergenic
1199841374 X:151653018-151653040 GAGAATAGACTGTGGGAGGAAGG + Intronic
1200597738 Y:5166608-5166630 GAGGATAAACAGTTGGAACATGG + Intronic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201516636 Y:14825332-14825354 GAGGAGAGACAGTGGAAGGAGGG - Intronic