ID: 1141457502

View in Genome Browser
Species Human (GRCh38)
Location 16:84153381-84153403
Sequence AAGTTTTATTTTAAGTTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4680
Summary {0: 1, 1: 0, 2: 92, 3: 1235, 4: 3352}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141457502_1141457506 19 Left 1141457502 16:84153381-84153403 CCCATCAACTTAAAATAAAACTT 0: 1
1: 0
2: 92
3: 1235
4: 3352
Right 1141457506 16:84153423-84153445 AATTTTTGTGGAAAAAATATAGG 0: 1
1: 0
2: 3
3: 90
4: 868
1141457502_1141457504 7 Left 1141457502 16:84153381-84153403 CCCATCAACTTAAAATAAAACTT 0: 1
1: 0
2: 92
3: 1235
4: 3352
Right 1141457504 16:84153411-84153433 TAAAATAACCAAAATTTTTGTGG 0: 1
1: 0
2: 4
3: 75
4: 768

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141457502 Original CRISPR AAGTTTTATTTTAAGTTGAT GGG (reversed) Intronic
Too many off-targets to display for this crispr