ID: 1141460949

View in Genome Browser
Species Human (GRCh38)
Location 16:84178630-84178652
Sequence CTCCGCTGCGCCTCAGCTGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141460949_1141460956 17 Left 1141460949 16:84178630-84178652 CCCACAGCTGAGGCGCAGCGGAG 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1141460956 16:84178670-84178692 GACTAAAATCCCAGCAACACAGG 0: 1
1: 0
2: 5
3: 305
4: 10670
1141460949_1141460957 25 Left 1141460949 16:84178630-84178652 CCCACAGCTGAGGCGCAGCGGAG 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1141460957 16:84178678-84178700 TCCCAGCAACACAGGCCCACCGG 0: 1
1: 0
2: 1
3: 56
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141460949 Original CRISPR CTCCGCTGCGCCTCAGCTGT GGG (reversed) Exonic
900738778 1:4317625-4317647 CACCGCTTCTCCTCATCTGTTGG + Intergenic
901233323 1:7653218-7653240 CTCCACTGAGCCTCTGCTGTGGG - Intronic
901634406 1:10663892-10663914 CTCCGCTCCCCGTCAGCTGCGGG + Intronic
902560928 1:17277044-17277066 CTCAGCTCGGCCCCAGCTGTGGG - Intronic
903467102 1:23559311-23559333 CTCAGCGGCTCCTCAGCTGCCGG + Exonic
915930201 1:160055775-160055797 CTCCTCTGCACCTTAACTGTTGG + Intronic
918256289 1:182751546-182751568 CTCCTCTGAGCCACAGCTCTGGG - Intergenic
924285080 1:242477539-242477561 CTCCCCTGCGCCTCAACTGCGGG - Intronic
1063248058 10:4244477-4244499 CTGCACTGCGGCTCAGCTGAGGG + Intergenic
1065603049 10:27389211-27389233 CTGAGCTGGGCCTCAGCTGAGGG + Intergenic
1067107352 10:43374947-43374969 CTCCCCTGGGCCTCAGCTCCAGG + Intronic
1070768159 10:79068232-79068254 CCCCGCTCCCCCACAGCTGTCGG + Intergenic
1071574663 10:86716522-86716544 CTCCGCAGGGCCCCCGCTGTAGG - Exonic
1077559992 11:3254155-3254177 CACCGCTGGGCCTCAGTTGCAGG - Intergenic
1077565885 11:3299958-3299980 CACCGCTGGGCCTCAGTTGCAGG - Intergenic
1082097023 11:48139286-48139308 CTGCTCTGAGCCTCAGCTGCAGG - Intronic
1084163925 11:67366393-67366415 CTCCCCAGCCCCTCAGCTGGTGG - Intronic
1084322300 11:68380373-68380395 CTCAGCTCTGCCGCAGCTGTAGG - Intronic
1084516773 11:69641849-69641871 CCCGGCTGCGCCTCAGCGGCCGG + Intronic
1085464549 11:76715028-76715050 TGCTGCTGCTCCTCAGCTGTGGG + Intergenic
1089500777 11:118930037-118930059 CTGCGCTGGGCCTCAGAAGTGGG - Intronic
1095159981 12:38905171-38905193 CTGGGCTGTGACTCAGCTGTGGG - Intronic
1097250886 12:57631885-57631907 CTGCGCTGCGCCGCCGCGGTCGG + Intronic
1101545615 12:105709635-105709657 CTCAGCTGTGCCTCAGATGATGG - Intergenic
1103747095 12:123132340-123132362 CTCAGCTGGGCCACAGGTGTGGG + Intronic
1105898749 13:24739830-24739852 CCCCTCTGGGCCTCAGCTCTAGG - Intergenic
1113567163 13:111326084-111326106 CTCCGCTGCGTCCAAGCTGGTGG + Intronic
1113920627 13:113906735-113906757 CTCTGCTGAGCCTTAGCTGTGGG - Intergenic
1115027197 14:28759241-28759263 CCCCGGTGCCCCTCAGCTGGGGG + Intergenic
1118308290 14:64674213-64674235 CTCCTCTCCTCCTCACCTGTTGG - Intergenic
1119759526 14:77141094-77141116 CTGCGCTGCGCCCCAGCGGTAGG - Intronic
1120852260 14:89181829-89181851 CTCCCCTGCCCCTCAGACGTAGG - Intronic
1121931098 14:97972911-97972933 CTCCTCTGCCCCTCACCTGATGG - Intronic
1131458372 15:92600998-92601020 CTCAGCTGTGTCTCAGCTCTGGG + Intergenic
1132378418 15:101348185-101348207 CTCCGCTGCTCCTCCCCGGTGGG + Intronic
1132751808 16:1461098-1461120 CCCGGGTGCGCCTCAGATGTTGG - Intronic
1133817983 16:9212739-9212761 GTCTGCTGCTCCCCAGCTGTGGG - Intergenic
1136112721 16:28074972-28074994 CTGGGCTGTGCCTCAGCTGGTGG - Intergenic
1137932684 16:52603718-52603740 CTCCTGTGCGCCTCTGCTGGAGG + Intergenic
1141460949 16:84178630-84178652 CTCCGCTGCGCCTCAGCTGTGGG - Exonic
1142788565 17:2244886-2244908 CTCAGCTGAGCGGCAGCTGTTGG - Intronic
1142909249 17:3072936-3072958 CTCTGTTGCTCCCCAGCTGTAGG + Intergenic
1142925311 17:3231302-3231324 CTCTGTTGCTCCCCAGCTGTAGG - Intergenic
1143230677 17:5351757-5351779 CACCACTGCACTTCAGCTGTGGG + Intronic
1143647807 17:8242984-8243006 CTACACTGCCCCTCAGCTATAGG - Exonic
1144789290 17:17848433-17848455 CTCTCCTGGGCCTCAGCTGATGG - Intronic
1145060619 17:19731038-19731060 CTCAGCTCCGCCTCTGCTGTGGG - Intergenic
1146054131 17:29572805-29572827 CTCCGCTTCAGCACAGCTGTGGG - Exonic
1146283565 17:31559907-31559929 CTCCGCTCCGCCGAAGCTCTGGG - Intergenic
1147577225 17:41609813-41609835 CTCCCCTGCTCCTCTGCTGGTGG - Exonic
1148543712 17:48501036-48501058 CTCCGCTTTGCATCAGCTATGGG - Intergenic
1152730372 17:81967038-81967060 CTGCCCTGCGCCCCAGCTGCTGG + Intergenic
1155470856 18:26190705-26190727 TGCCGCTGTGCTTCAGCTGTAGG + Intronic
1156535643 18:37862188-37862210 CTCTGCTGTCTCTCAGCTGTGGG + Intergenic
1157573300 18:48727639-48727661 CTCCGCTGGGCTTCTGCTGAGGG + Intronic
1161216490 19:3097324-3097346 CTCCCCTGCCCCTTAGCAGTGGG + Intronic
1161258008 19:3320440-3320462 CTCCTAGGCGCCTCAGATGTGGG - Intergenic
1162113302 19:8413149-8413171 CCCCGCTGTGCCGCAGCTGCTGG - Intronic
1166576170 19:43840447-43840469 CTCAGCTCCACCACAGCTGTGGG - Intronic
1167416471 19:49375785-49375807 CTCCGCTGGCCCTCAGCTCTGGG + Intergenic
1168584108 19:57578787-57578809 CCCCGCTGCGCATCAGCCGGTGG - Exonic
926276029 2:11403873-11403895 CTCCACTGGCCCTCAGCTGTGGG + Intergenic
927199414 2:20569078-20569100 CTGGGCTGCGGCTGAGCTGTAGG - Intronic
934459940 2:94208441-94208463 CTCCACCGCGCCGCCGCTGTCGG + Intergenic
934459972 2:94208589-94208611 CTCCACCGCGCCGCCGCTGTCGG + Intergenic
934657131 2:96122250-96122272 CTCCTCTCGGCCTCTGCTGTTGG - Intergenic
934839526 2:97616304-97616326 CTCTGCCCCGCCTCAGCTGCTGG - Intergenic
935713104 2:105916670-105916692 CTCCACTGCTCCTCTGCTGCGGG + Intergenic
942145578 2:173023392-173023414 CTCTGCTGTGCCTTATCTGTAGG + Intronic
942665719 2:178314783-178314805 CTCCACTGCTCATTAGCTGTTGG - Intronic
1175789933 20:61734894-61734916 CTGCGCTGGGCCTCAGCCCTGGG - Intronic
1177900951 21:26914445-26914467 CTCAGCTGGGCCTCTGCTCTGGG + Intergenic
1178099346 21:29250756-29250778 CTCGGTTCCTCCTCAGCTGTTGG - Intronic
1180231282 21:46428244-46428266 ATCTGCTGGGCCTCAGCTCTGGG - Intronic
1181458030 22:23070600-23070622 CGCCGCTGAGCCTCAGGGGTCGG + Intronic
1181468277 22:23122445-23122467 CTCCCCTGCCCTCCAGCTGTGGG - Intronic
1183219994 22:36506392-36506414 CTCCGCTGCGGCCCCGTTGTGGG - Exonic
1184892395 22:47388042-47388064 CTCTGCTGAGCCTCAGGTGTGGG + Intergenic
1185006090 22:48277803-48277825 TTCTGCTGCCCCTCGGCTGTGGG - Intergenic
1185136029 22:49073175-49073197 CTCTGCTGCTGCTCAGCTCTAGG + Intergenic
949813669 3:8035614-8035636 CTCTGCTGCCACTCAGCTGCTGG - Intergenic
953172972 3:40524653-40524675 ACGGGCTGCGCCTCAGCTGTTGG - Intergenic
953931665 3:47008828-47008850 CTCCGCTTAGCCACAGTTGTGGG + Intronic
958921342 3:100109483-100109505 CTCCCCTCAGCGTCAGCTGTTGG + Intronic
961447547 3:126987944-126987966 CTCCGTGGTGCCTCTGCTGTGGG + Intergenic
961477404 3:127157408-127157430 CTCTGCTGCCTCTCACCTGTGGG + Intergenic
961641229 3:128365896-128365918 CCCCGCTTTGCCTCAGCCGTTGG + Intronic
963253524 3:143121872-143121894 CTCGGCTGCGCACCACCTGTAGG - Exonic
964315890 3:155444002-155444024 CTCAGCTGTGCATAAGCTGTTGG - Intronic
965779113 3:172265257-172265279 CTACTCTGTGTCTCAGCTGTTGG + Intronic
968734366 4:2287772-2287794 CACCGCTGTGCGTCAGCAGTGGG + Intronic
968966703 4:3772518-3772540 CTCCTCTGCTCCTCAGCTCTAGG - Intergenic
971266401 4:25099737-25099759 CTCAGCTGTGCCTCATCAGTTGG - Intergenic
975041055 4:69744283-69744305 GGCCGCTGCGCCTCCGCTGAGGG - Intronic
976281988 4:83334807-83334829 CTCCGCTGCGCGGCAGCTGGCGG - Exonic
979232651 4:118363370-118363392 GTCTGCTCAGCCTCAGCTGTGGG - Intergenic
981963970 4:150579656-150579678 CTCCGCTGCACCTCCACTGGCGG - Intronic
989547672 5:42693528-42693550 GACAGCTGCTCCTCAGCTGTTGG - Intronic
992448016 5:76851143-76851165 CTCCGATGCCCCTCAGCTCCTGG - Intronic
1003626000 6:7741824-7741846 CTCTGCTACCCCTCAGCTGTGGG + Intronic
1004614900 6:17280870-17280892 CGCCGCCGCCCCCCAGCTGTTGG - Intergenic
1016016661 6:139193443-139193465 CTCAGCTGCGTCTCAGCTCCAGG + Intergenic
1017498593 6:155003569-155003591 CCCAGCTGTGCCTCAGCTGTGGG + Intronic
1023231356 7:38033561-38033583 CTCTGCTGTGCTTCAGATGTAGG + Intergenic
1024930689 7:54664491-54664513 CACCGCTGCAGCTCAGCTCTGGG + Intergenic
1026589743 7:71684432-71684454 CTGGGCTGCGGGTCAGCTGTAGG - Intronic
1027184309 7:75961327-75961349 CTCAGCTGCTCCACAGCTGGTGG - Intronic
1029016096 7:97316630-97316652 CTCTTCTGCTCCTCTGCTGTTGG - Intergenic
1029475542 7:100781540-100781562 CTCAGCTGCCCCACAGCTGCTGG + Intronic
1034936001 7:155201422-155201444 CTCCGCTGAGCCTCAACCATAGG - Intergenic
1035127085 7:156616564-156616586 CTCCGCTCCGCTACAGCTGCAGG + Intergenic
1038312741 8:26457261-26457283 CTGCTCTGCACCTCAGCAGTTGG + Intronic
1039216810 8:35281086-35281108 CTTCGCTGTGCCTCAGATCTCGG + Intronic
1042262152 8:66870775-66870797 CTCCGCTCCGCCTACGCTGCAGG + Exonic
1044300090 8:90573599-90573621 CTCCACTGTTCTTCAGCTGTGGG + Intergenic
1048362039 8:133705857-133705879 CTGAGCTGCCCCTCAGATGTCGG - Intergenic
1053569740 9:39291877-39291899 TCCCTCTGCGCCTCTGCTGTAGG - Intergenic
1054091370 9:60850882-60850904 TCCCTCTGCGCCTCTGCTGTAGG - Intergenic
1054112785 9:61126452-61126474 TCCCTCTGCGCCTCTGCTGTAGG - Intergenic
1054127408 9:61327136-61327158 TCCCTCTGCGCCTCTGCTGTAGG + Intergenic
1054460351 9:65459044-65459066 CTCTGCTGCCACTCAGGTGTGGG - Intergenic
1056962282 9:91136214-91136236 CTCTGCGGGGTCTCAGCTGTGGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic