ID: 1141463273

View in Genome Browser
Species Human (GRCh38)
Location 16:84191044-84191066
Sequence AGTGCACCCTGCCAATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 134}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141463273_1141463277 -3 Left 1141463273 16:84191044-84191066 CCTTCCCATTGGCAGGGTGCACT 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1141463277 16:84191064-84191086 ACTGTCCATCACAGATCTCAGGG 0: 1
1: 0
2: 1
3: 11
4: 142
1141463273_1141463281 22 Left 1141463273 16:84191044-84191066 CCTTCCCATTGGCAGGGTGCACT 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1141463281 16:84191089-84191111 CTCATTGGCCATCGTATGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 56
1141463273_1141463283 24 Left 1141463273 16:84191044-84191066 CCTTCCCATTGGCAGGGTGCACT 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1141463283 16:84191091-84191113 CATTGGCCATCGTATGGCAGGGG 0: 1
1: 0
2: 0
3: 2
4: 53
1141463273_1141463280 18 Left 1141463273 16:84191044-84191066 CCTTCCCATTGGCAGGGTGCACT 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1141463280 16:84191085-84191107 GGCTCTCATTGGCCATCGTATGG 0: 1
1: 0
2: 1
3: 4
4: 58
1141463273_1141463282 23 Left 1141463273 16:84191044-84191066 CCTTCCCATTGGCAGGGTGCACT 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1141463282 16:84191090-84191112 TCATTGGCCATCGTATGGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1141463273_1141463279 7 Left 1141463273 16:84191044-84191066 CCTTCCCATTGGCAGGGTGCACT 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1141463279 16:84191074-84191096 ACAGATCTCAGGGCTCTCATTGG 0: 1
1: 0
2: 3
3: 12
4: 143
1141463273_1141463276 -4 Left 1141463273 16:84191044-84191066 CCTTCCCATTGGCAGGGTGCACT 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1141463276 16:84191063-84191085 CACTGTCCATCACAGATCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 118
1141463273_1141463284 27 Left 1141463273 16:84191044-84191066 CCTTCCCATTGGCAGGGTGCACT 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1141463284 16:84191094-84191116 TGGCCATCGTATGGCAGGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141463273 Original CRISPR AGTGCACCCTGCCAATGGGA AGG (reversed) Intergenic
901535956 1:9883166-9883188 AGTCCAACCTGCCAAGCGGAGGG + Intronic
902240378 1:15084335-15084357 AGTGCACACAGCCAGAGGGACGG + Intronic
907575361 1:55521379-55521401 AGTGCAGCCTGCCTCTTGGAGGG - Intergenic
907602978 1:55788667-55788689 AGAGCTCCCATCCAATGGGAGGG + Intergenic
909291845 1:73892898-73892920 ATTGCACTCTGCCATTGTGATGG + Intergenic
911098164 1:94072833-94072855 ATTTCCCCCTGCTAATGGGAGGG + Intronic
916396495 1:164394497-164394519 AGTGCACCCTGCTCAGGTGATGG + Intergenic
918494219 1:185115312-185115334 AGTGCACCCTGCCAAGGGATGGG + Intergenic
919730862 1:200912893-200912915 AGAGCACCCTGACACTGGGTAGG + Intronic
923014043 1:230112320-230112342 AGTGCAGCCTGCACATGGGGTGG + Intronic
1069728044 10:70593841-70593863 TGTGCTTCCTGCCATTGGGAGGG + Intergenic
1074347025 10:112696710-112696732 AGTGCACACTGACAAAGTGATGG - Intronic
1076383392 10:130040060-130040082 AGTGCACTCAGCCCATGGAAAGG - Intergenic
1076400430 10:130180490-130180512 AGTGCAGGCTTCAAATGGGATGG + Exonic
1076535329 10:131173546-131173568 AGGGAACCCTGCCCCTGGGAAGG + Intronic
1076727726 10:132421280-132421302 AGTGCACCCTTCCCATGGCTGGG - Intergenic
1076774194 10:132685248-132685270 ACTGCATTCTGCCACTGGGAAGG - Intronic
1076931964 10:133537341-133537363 AGTGACCCCTGCCAAAGGGAAGG - Intronic
1083264870 11:61542086-61542108 TTGGCACCCTGCCAAGGGGATGG + Intronic
1085796154 11:79541819-79541841 AATGCCCCCAGCCAAGGGGAGGG - Intergenic
1088752470 11:112856252-112856274 AGTTCATCCAGCCAATGGCATGG + Intergenic
1089626536 11:119754729-119754751 AGTGCCCCTGGCCAAGGGGATGG - Intergenic
1089905569 11:122034444-122034466 AGTGCACACTGCTATTGAGATGG - Intergenic
1091560089 12:1605612-1605634 AGTGCACCCTGCCGAGCAGAAGG + Intronic
1095606459 12:44073329-44073351 AGTTCACCCAGCCAATAGGAAGG - Intronic
1096808067 12:54152433-54152455 ACTGCTCTCTGCCACTGGGAAGG - Intergenic
1099365285 12:81759569-81759591 AGTGCCCCCTGCGAAGGCGAGGG + Intergenic
1103303374 12:119945024-119945046 ACTGCACCCAGCCAATCTGATGG + Intergenic
1103896835 12:124278621-124278643 TGTGCACGGTGCCAAAGGGAGGG + Intronic
1104367092 12:128187691-128187713 AGTGGGACCTGTCAATGGGAGGG - Intergenic
1107657222 13:42604101-42604123 AGTCTACCCTCTCAATGGGATGG - Intronic
1107818069 13:44262044-44262066 AGTGCACCCAGCTCAGGGGAGGG + Intergenic
1108947985 13:56046442-56046464 AGAGCTCCCTTACAATGGGAAGG + Intergenic
1110908780 13:80928460-80928482 AGAGCAACCTGCCTAAGGGAGGG + Intergenic
1111103074 13:83612155-83612177 TTTGCAGCCTGACAATGGGATGG - Intergenic
1113923707 13:113928882-113928904 AGGGCAGCCTGCCAAGGAGAAGG + Intergenic
1114306376 14:21427297-21427319 AGTGCTCCTTGCTATTGGGATGG - Intronic
1114306383 14:21427344-21427366 AGTGCTCCTTGCTACTGGGATGG - Intronic
1122855187 14:104556667-104556689 AGTGGACACTGGCAATGGGCTGG + Intronic
1122920180 14:104876722-104876744 AGTGGACCCTGCAGATGGGAAGG + Intronic
1123130699 14:105983168-105983190 AGTGCACCATGCCATTGGGTAGG + Intergenic
1123580932 15:21714390-21714412 AGTGCACCATGCCATTTGGTAGG + Intergenic
1123617581 15:22157013-22157035 AGTGCACCATGCCATTTGGTAGG + Intergenic
1124628644 15:31325468-31325490 AGTGGACCCTCGCAGTGGGAGGG - Intergenic
1128079047 15:64845418-64845440 TGTGAACCCTGCCAAGGGGAGGG + Intronic
1128113202 15:65089242-65089264 AGTGCAAGCTGTCAAAGGGAAGG - Intergenic
1128800155 15:70492174-70492196 AGTGCACCCAGGTAAGGGGAGGG + Intergenic
1134121058 16:11585759-11585781 AGTGCACCAGGCCAAGGGGAGGG + Intronic
1135435238 16:22422391-22422413 ACTGCACCCAGCCAATCTGATGG - Intronic
1136576013 16:31125799-31125821 AGTACAGCCTGACAATGGAAGGG - Intronic
1140903403 16:79391016-79391038 AGTGGACCCTGGCAGTGTGACGG - Intergenic
1141463273 16:84191044-84191066 AGTGCACCCTGCCAATGGGAAGG - Intergenic
1143852664 17:9824303-9824325 AGGGCAACCAGCCAATGGGTGGG + Intronic
1144043318 17:11431978-11432000 AGAGCACTCTGCTAATGGCAAGG - Intronic
1147263062 17:39219932-39219954 TGGCCACCCTGCCAAGGGGATGG + Intronic
1147773181 17:42881911-42881933 ACTGCACCCAGCCAAATGGATGG + Intergenic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1149258895 17:54857980-54858002 AGTGCAACCTGCCAAAGGCTAGG + Intergenic
1149526355 17:57359068-57359090 AGGGGCCCCTGCCACTGGGATGG - Intronic
1150763805 17:67987483-67987505 ACTGCGCCCTGCCAATTTGATGG - Intergenic
1151481182 17:74370800-74370822 AGAACACCCTGACAATGGCAAGG - Intronic
1152158207 17:78648907-78648929 ACTGCACCCTGCCGATCTGATGG - Intergenic
1152992928 18:379029-379051 AGTGCACCCTGCGTTGGGGAGGG - Intronic
1154033539 18:10775661-10775683 AATGCACCCTGCCTGTGGCATGG - Intronic
1156987397 18:43364348-43364370 ATGGCACTCTGCAAATGGGATGG - Intergenic
1161468123 19:4443441-4443463 AGTGCACCTTGCCCATGGCCCGG + Intronic
1163376816 19:16938259-16938281 AGTGCCCCCTTCCCAGGGGAAGG + Intronic
1164082901 19:21875947-21875969 CCTGCACCCTGCCAACAGGAAGG + Intergenic
1164190883 19:22916066-22916088 CCTGCACCCTGCCAACAGGAAGG + Intergenic
1166802984 19:45469430-45469452 AATGCACCCTACAAATAGGAAGG - Intronic
925244252 2:2366071-2366093 AGTGAACCCTGGCACTGGGTTGG + Intergenic
925505460 2:4557806-4557828 AGTGCACACTGCAATTGGGATGG + Intergenic
926266977 2:11331986-11332008 ACTGCACCTGGCTAATGGGAAGG - Intronic
928671911 2:33611133-33611155 AGTGCTCCCATACAATGGGAGGG + Intergenic
930175213 2:48294611-48294633 ACTGCACCCGGCCAAAGGGTGGG - Intergenic
934572034 2:95378950-95378972 CGTGCACCCTGCGAATGTGTTGG - Intronic
934787184 2:97020217-97020239 ACTGCAGCCTCCCAATGGGCTGG - Intergenic
934945457 2:98537953-98537975 TGTGGACACTGTCAATGGGAGGG + Exonic
936236550 2:110747363-110747385 GCTGCACTCTGCCCATGGGATGG - Intronic
936835311 2:116702677-116702699 AGTGCAGCCTGCCAGAGAGAAGG + Intergenic
938803869 2:134788103-134788125 AGTGCAGCCTGCAGAGGGGAGGG - Intergenic
940928598 2:159397943-159397965 AGGGCACCATTCCAAGGGGATGG + Intronic
941885233 2:170520914-170520936 AGTGGACCATGGCAAAGGGAAGG + Intronic
943279258 2:185910345-185910367 ACTGCGCCCTGCCATTGGGCAGG + Intergenic
945259191 2:207828602-207828624 GGACAACCCTGCCAATGGGAAGG + Intronic
946105003 2:217361322-217361344 ACTGCTCCCTGCCAGTTGGAGGG + Intronic
946194615 2:218025614-218025636 ACTGCACTCTGCCAATGGCAGGG - Intergenic
948336010 2:237207544-237207566 AGTGCAGCCGGGCGATGGGATGG + Intergenic
1170303024 20:14907279-14907301 AGAGCACACTGACTATGGGATGG + Intronic
1170491967 20:16886420-16886442 AGGCCACTCTGCCAGTGGGAGGG + Intergenic
1170520186 20:17177281-17177303 AGAGCCCCCTTGCAATGGGAAGG - Intergenic
1173402124 20:42734968-42734990 AGTGTACTCTGCCCATGGGGAGG + Intronic
1175118156 20:56698248-56698270 ACAGCACCCAGCCTATGGGAGGG + Intergenic
1181102981 22:20554001-20554023 ACTGCATTCTGCCATTGGGAAGG + Intronic
1182661297 22:31927133-31927155 AGGACACCTAGCCAATGGGAAGG - Intergenic
1183738147 22:39655181-39655203 AGCACACCCGGCCCATGGGAGGG + Intronic
949980839 3:9500866-9500888 CCTGCTCCCTGCCAAGGGGAAGG + Exonic
955101547 3:55854655-55854677 AGAGCATCCTGGCAATAGGAAGG - Intronic
963901219 3:150735191-150735213 ATGGCACTGTGCCAATGGGAAGG - Intergenic
963916542 3:150864168-150864190 AATGCACCCAGCCAATCTGATGG - Intergenic
969508830 4:7605609-7605631 ATTGCTCCCTTCCCATGGGAAGG + Intronic
973991791 4:56416162-56416184 AATGGACCATGTCAATGGGATGG + Intronic
978129266 4:105174878-105174900 AGTGTAACCTCCCAAAGGGAAGG + Intronic
978305030 4:107318357-107318379 AGTGAGCCATGCCAAAGGGAAGG - Intergenic
980878699 4:138687683-138687705 AGTGCATCCTGCCTATCGGGAGG + Intergenic
981004074 4:139857245-139857267 TGTGCACCCAGCCAAGCGGAAGG + Intronic
985178821 4:187233683-187233705 AGTTCTCCCTGCCAATGAAATGG - Intergenic
986988344 5:13524064-13524086 AGTGCAGGCTGCCCACGGGAGGG + Intergenic
988918549 5:35920200-35920222 AGTACAGGGTGCCAATGGGAGGG - Intronic
991040360 5:62169040-62169062 AGTGCACCCTGGGAAAGGAAGGG - Intergenic
991454104 5:66784014-66784036 AAGGCTCCCTGCCAGTGGGAGGG - Intronic
992695782 5:79285397-79285419 ATAGCACCCAGCCAAGGGGATGG - Intronic
999551207 5:152689230-152689252 AGCCCACCCTGCTAATGAGATGG - Intergenic
1001011285 5:168101023-168101045 AGTGCACTCTGTCAATGGCAGGG + Intronic
1002156042 5:177280570-177280592 TCTGTACCCTGCCAATAGGACGG - Exonic
1006836003 6:36999203-36999225 AGGCCACACTGCCGATGGGAGGG - Intergenic
1009894833 6:69735222-69735244 AGTGCACCCTGCAGTTGGAATGG - Intronic
1017053242 6:150413857-150413879 TGGGCACCCTGCCAATGGGGTGG - Intergenic
1019684561 7:2373863-2373885 AGTGCACCCTGGCAGGGGCAGGG - Intronic
1019909586 7:4091629-4091651 ACTGCACCCTGCCAACAGCAAGG + Intronic
1019943631 7:4310122-4310144 AGTCAGCCCTGCCTATGGGATGG - Intergenic
1022301650 7:29107591-29107613 AGTGCAGCCAGTCAATGGGCTGG - Intronic
1022446051 7:30471681-30471703 AGGGCCCCCTGGCTATGGGAAGG - Intronic
1023109663 7:36796553-36796575 AGTGCACCCTGCAATGGGGATGG + Intergenic
1024148010 7:46536737-46536759 AGGACACCCTGCCAAAGGGAGGG + Intergenic
1024212623 7:47218701-47218723 AATGCAAGCTGCCAAGGGGAGGG + Intergenic
1027734882 7:81920213-81920235 AGGGCAACCTGCCTATGGAAAGG - Intergenic
1028140033 7:87263562-87263584 ACTGCAGCCTGGCAAGGGGAGGG - Intergenic
1031738475 7:125397399-125397421 AGTGAGCTCTGCCAATGGAAGGG + Intergenic
1033430121 7:141281589-141281611 AATGCACCCTGGTAATGGGAGGG + Intronic
1035271421 7:157722284-157722306 ACTGCAGCCTGGCATTGGGAAGG + Intronic
1036796988 8:11763502-11763524 AGGGGACTCTGCCAGTGGGAAGG - Exonic
1040666815 8:49643359-49643381 AATTCACACTGCCAATGAGATGG - Intergenic
1040811289 8:51456454-51456476 AGTGCTCCCCTCCACTGGGATGG + Intronic
1040816929 8:51518699-51518721 ACTGCACCCTGAGAATGAGAGGG + Intronic
1042869605 8:73386328-73386350 AGTGCTCCCTTCCCAGGGGATGG + Intergenic
1048669781 8:136704961-136704983 AGTGCTCCTTTCCAAAGGGAAGG - Intergenic
1048773880 8:137923929-137923951 TGTGGCCCCTGTCAATGGGAAGG - Intergenic
1048846112 8:138604987-138605009 AGAGCTCCTTGTCAATGGGATGG + Intronic
1049720807 8:144114695-144114717 AGCCCTCCCTGCCACTGGGAAGG + Intronic
1053265020 9:36706228-36706250 ACTGCACCCAGCCAATCTGATGG - Intergenic
1057937018 9:99249047-99249069 AGTGACCCCTGCCCATGGAAAGG + Intergenic
1057937091 9:99249426-99249448 AGTGACCCCTGCCCATGGAAAGG + Intergenic
1057937126 9:99249591-99249613 AGTGACCCCTGCCCATGGAAAGG + Intergenic
1062020451 9:134316911-134316933 AGTGCAGCCTGCCTGGGGGAGGG + Intergenic
1190161943 X:48038477-48038499 ACTGCAGGCTGCCAAAGGGAAGG + Intronic
1192118665 X:68434292-68434314 AGTGCCCCCTGCCAAAGAAAGGG + Intergenic
1198421138 X:136471659-136471681 AGTGCACTCTGCTAATTGGTAGG - Intergenic
1200795747 Y:7339737-7339759 ATTGCACTCTGCAAATGGCAAGG - Intergenic