ID: 1141463908

View in Genome Browser
Species Human (GRCh38)
Location 16:84194711-84194733
Sequence GCATCAGGACGTCACCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141463908 Original CRISPR GCATCAGGACGTCACCTGCA GGG Intronic
904372357 1:30057772-30057794 GCTTCAGCTCCTCACCTGCAAGG - Intergenic
906708788 1:47914169-47914191 GGCTCACGACGTCACCTGCCAGG - Intronic
910564398 1:88626801-88626823 GGATTAGGACATCATCTGCAAGG + Intergenic
911089396 1:94006554-94006576 CCATGAGGAAGTCACCTGCGTGG + Intronic
917204837 1:172561447-172561469 GCATCAGGGCACCACCTTCATGG - Intronic
918616791 1:186553387-186553409 GCATCATGACCCCACCTGCCTGG - Intergenic
921274843 1:213508987-213509009 ACATCATGACATCACCTCCAAGG - Intergenic
923611976 1:235504126-235504148 GCCCCAGGACCTCACCTGCAGGG + Exonic
1063270179 10:4499810-4499832 GCAGCAGGAGGACACCAGCAGGG + Intergenic
1063964691 10:11337875-11337897 GCAGCTGGAAGTCACCTGCCGGG + Intergenic
1065945750 10:30604408-30604430 GCATCAGGACCCCATCTTCAGGG + Intergenic
1075903567 10:126062461-126062483 GCAATAGGAAGTCACCTGCTTGG - Intronic
1077334373 11:1996926-1996948 GCAGCAGGACGTCACCAGGAGGG - Intergenic
1081042520 11:38229167-38229189 GCATCAGGATATTACCAGCAGGG - Intergenic
1081573256 11:44304261-44304283 GCACCCGGACGTCGCCTGCCAGG - Intronic
1083596915 11:63922078-63922100 GCAGCAGGAACTCACATGCAGGG - Intergenic
1085503680 11:77043374-77043396 TCATCACCACGTCACCTTCAGGG + Intergenic
1091328985 11:134715762-134715784 GGACCAGGACGTCTCCTACAAGG - Intergenic
1202817356 11_KI270721v1_random:52108-52130 GCAGCAGGACGTCACCAGGAGGG - Intergenic
1097924184 12:65109542-65109564 GCTTCAGGAAGTCACCAGCTGGG - Intronic
1098270224 12:68762794-68762816 GTCTCAGGAAGTCACCTTCATGG + Intronic
1101343017 12:103859890-103859912 GCAACAAGAGGTCACCTGCCTGG + Intergenic
1102921304 12:116793597-116793619 GCACCAAGAAGTCACCAGCATGG - Intronic
1110057229 13:70988181-70988203 GAATCAGGAAGTTACCTCCAGGG + Intergenic
1110684649 13:78357870-78357892 GCATCAGGAAGTTACCTATATGG + Intergenic
1113566626 13:111323224-111323246 GCCTCAGGCCATCACCTGCTAGG - Intronic
1115811640 14:37115426-37115448 ACATGAGGACGGCCCCTGCATGG + Intronic
1118599193 14:67459535-67459557 GTATCAGGGTGTGACCTGCATGG - Intronic
1123012617 14:105356659-105356681 TCAGCAGGACCTCGCCTGCATGG - Intronic
1123012629 14:105356711-105356733 TCAGCAGGACCTCGCCTGCATGG - Intronic
1123012641 14:105356763-105356785 TCAGCAGGACCTCGCCTGCATGG - Intronic
1123012652 14:105356815-105356837 TCAGCAGGACATCGCCTGCATGG - Intronic
1123012673 14:105356919-105356941 TCAGCAGGACATCGCCTGCATGG - Intronic
1123012684 14:105356971-105356993 TCAGCAGGACATCGCCTGCATGG - Intronic
1123012692 14:105357015-105357037 TCAGCAGGACATCACCTGCATGG - Intronic
1130311143 15:82755722-82755744 TCATCAGGAAGTCTCCTGGAAGG - Exonic
1130319591 15:82829519-82829541 GCTGCAGGACGGCAGCTGCATGG + Intronic
1140081194 16:71749137-71749159 GGATCATGAGGTCACCTGCAGGG - Intronic
1141463908 16:84194711-84194733 GCATCAGGACGTCACCTGCAGGG + Intronic
1142220153 16:88850294-88850316 GCCTCAGGACGCAGCCTGCAGGG - Intronic
1146953221 17:36920903-36920925 GGATCAGGAGTTCACCCGCAGGG + Intergenic
1152031360 17:77845508-77845530 GCCTCAGGAGGTGACCTGCTTGG - Intergenic
1162418377 19:10552037-10552059 ACAGCAGGAAGTCATCTGCAGGG - Exonic
1162637967 19:11985189-11985211 GCAGCTGGAGGCCACCTGCAGGG - Intergenic
1162705707 19:12553309-12553331 GCAGCTGGAGGCCACCTGCAAGG + Intronic
926912109 2:17860751-17860773 TTATCAGGTCGTTACCTGCATGG + Intergenic
927705752 2:25295339-25295361 GAAACAGGAAGTCAGCTGCAGGG - Intronic
936482579 2:112898636-112898658 TCATCGGAACTTCACCTGCATGG + Intergenic
1173551224 20:43934397-43934419 GCCTCAGCTCCTCACCTGCACGG - Intronic
1175842337 20:62036979-62037001 GCAGCAGGCCCTCACCAGCATGG + Intronic
1181405552 22:22681985-22682007 GCACCAGGACGTCACAAGCAAGG + Intergenic
1184226055 22:43129353-43129375 GCAGCAGGCCGCCACCTCCAGGG - Exonic
1184232755 22:43167509-43167531 GCATCAGGACGACCCCGGGACGG - Exonic
1184470082 22:44691289-44691311 GAGTCCTGACGTCACCTGCAGGG - Intronic
953138138 3:40201505-40201527 GCACCAGGATGTCATCTGGAAGG - Intronic
955006937 3:54977728-54977750 GCATCATGATGTTACCTGAAAGG + Intronic
972450646 4:39194892-39194914 GCATCAGGACATTAACAGCATGG + Intronic
981246099 4:142540582-142540604 GCCTCAGGACTTCATCTGGATGG - Intronic
981542354 4:145859216-145859238 GAATAAGGACCTCACCTGCATGG - Intronic
988548320 5:32177542-32177564 GCAGCAGCACCTAACCTGCAGGG - Intergenic
998468380 5:142364041-142364063 TCATCAGGACCTCATCTGAATGG - Intergenic
1001118405 5:168958721-168958743 AGATCAGAAGGTCACCTGCAAGG + Intronic
1006786863 6:36673990-36674012 GCATCAGGACTTCCCCAGCGTGG + Intergenic
1011906286 6:92372610-92372632 GTATAAGGAAGTCATCTGCACGG + Intergenic
1013008750 6:106100767-106100789 GCATCAGGACCTCCCCCGTAGGG + Intronic
1019738466 7:2661624-2661646 GCATCAGCAGGGCCCCTGCATGG - Intronic
1023432844 7:40112625-40112647 GGATCAGGGCCTCACCTTCATGG + Intergenic
1026763409 7:73143670-73143692 TCATAGGGATGTCACCTGCATGG - Intergenic
1027039879 7:74953444-74953466 TCATAGGGATGTCACCTGCATGG - Intergenic
1027083760 7:75248920-75248942 TCATAGGGATGTCACCTGCATGG + Intergenic
1027608815 7:80333750-80333772 GAAACAGTACGTCACCTGCTGGG + Intergenic
1029391355 7:100276770-100276792 TCATAGGGATGTCACCTGCATGG + Intergenic
1032079317 7:128850795-128850817 GCATCCGCACCTCTCCTGCAGGG - Exonic
1034759825 7:153660916-153660938 GCATGAGGGTGTCACCTGCATGG + Intergenic
1035309462 7:157955999-157956021 TCATCAGGATGTCAGCTGCTGGG + Intronic
1039461522 8:37749590-37749612 GCAACAGGACCTGACCTCCATGG + Exonic
1043476648 8:80611716-80611738 GCATGAGGAGGTCACCTGTTTGG + Intergenic
1043738674 8:83778757-83778779 GCATCATGAAGTGACCTGGAGGG - Intergenic
1048940954 8:139400288-139400310 GCAGCAGGATGTCACCTTCTGGG - Intergenic
1052358146 9:27527703-27527725 GCAACAGCAAGTCAACTGCAAGG + Intronic
1057527059 9:95812152-95812174 GCATAAGGACCACAGCTGCATGG - Intergenic
1061048982 9:128183032-128183054 GCACCAGGGAGTCCCCTGCAGGG + Intronic
1062421638 9:136485177-136485199 GAATCACCACATCACCTGCAGGG + Exonic
1185795546 X:2961311-2961333 GCAGCAAGAGGTCACCTTCAGGG + Intronic
1188612662 X:32118983-32119005 ACATCAGGAGGTGAGCTGCAGGG - Intronic
1192451235 X:71246383-71246405 GAATCGGGGCGTCTCCTGCAAGG - Exonic
1198306592 X:135389910-135389932 CCATGATGACATCACCTGCAAGG + Intergenic