ID: 1141465768

View in Genome Browser
Species Human (GRCh38)
Location 16:84204911-84204933
Sequence TCCAGCTGGTCCGCAAGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141465758_1141465768 4 Left 1141465758 16:84204884-84204906 CCCGCCAAGCCCACGCCTACCCG 0: 13
1: 369
2: 478
3: 424
4: 468
Right 1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG No data
1141465763_1141465768 -6 Left 1141465763 16:84204894-84204916 CCACGCCTACCCGGAACTCCAGC 0: 14
1: 462
2: 392
3: 436
4: 552
Right 1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG No data
1141465762_1141465768 -5 Left 1141465762 16:84204893-84204915 CCCACGCCTACCCGGAACTCCAG 0: 16
1: 445
2: 375
3: 421
4: 453
Right 1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG No data
1141465757_1141465768 19 Left 1141465757 16:84204869-84204891 CCTCATTGTCTGGGGCCCGCCAA No data
Right 1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG No data
1141465761_1141465768 0 Left 1141465761 16:84204888-84204910 CCAAGCCCACGCCTACCCGGAAC 0: 21
1: 637
2: 631
3: 391
4: 265
Right 1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG No data
1141465756_1141465768 20 Left 1141465756 16:84204868-84204890 CCCTCATTGTCTGGGGCCCGCCA No data
Right 1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG No data
1141465759_1141465768 3 Left 1141465759 16:84204885-84204907 CCGCCAAGCCCACGCCTACCCGG 0: 16
1: 454
2: 496
3: 362
4: 461
Right 1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG No data
1141465755_1141465768 21 Left 1141465755 16:84204867-84204889 CCCCTCATTGTCTGGGGCCCGCC No data
Right 1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141465768 Original CRISPR TCCAGCTGGTCCGCAAGTGC CGG Intergenic
No off target data available for this crispr