ID: 1141469088

View in Genome Browser
Species Human (GRCh38)
Location 16:84226353-84226375
Sequence GTGTAGGGATGGCCTGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141469079_1141469088 26 Left 1141469079 16:84226304-84226326 CCTCATCTAGGGTGCACAAAGTG 0: 1
1: 0
2: 0
3: 9
4: 98
Right 1141469088 16:84226353-84226375 GTGTAGGGATGGCCTGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141469088 Original CRISPR GTGTAGGGATGGCCTGTGAA GGG Intronic
No off target data available for this crispr