ID: 1141470653

View in Genome Browser
Species Human (GRCh38)
Location 16:84236199-84236221
Sequence CCTCATCTGAAAATGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141470645_1141470653 9 Left 1141470645 16:84236167-84236189 CCGAGGAAAATAAATGGCCCATG 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1141470653 16:84236199-84236221 CCTCATCTGAAAATGGAGTGGGG 0: 1
1: 0
2: 1
3: 25
4: 247
1141470643_1141470653 24 Left 1141470643 16:84236152-84236174 CCTTACTGTGGAGCTCCGAGGAA 0: 1
1: 0
2: 1
3: 7
4: 76
Right 1141470653 16:84236199-84236221 CCTCATCTGAAAATGGAGTGGGG 0: 1
1: 0
2: 1
3: 25
4: 247
1141470646_1141470653 -8 Left 1141470646 16:84236184-84236206 CCCATGCCTCAGTTTCCTCATCT 0: 30
1: 230
2: 909
3: 2208
4: 4093
Right 1141470653 16:84236199-84236221 CCTCATCTGAAAATGGAGTGGGG 0: 1
1: 0
2: 1
3: 25
4: 247
1141470647_1141470653 -9 Left 1141470647 16:84236185-84236207 CCATGCCTCAGTTTCCTCATCTG 0: 67
1: 379
2: 1116
3: 2190
4: 3586
Right 1141470653 16:84236199-84236221 CCTCATCTGAAAATGGAGTGGGG 0: 1
1: 0
2: 1
3: 25
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141470653 Original CRISPR CCTCATCTGAAAATGGAGTG GGG Intronic
902465717 1:16617139-16617161 CCACATCTCACTATGGAGTGAGG + Intergenic
903648118 1:24906838-24906860 TTTCATCTGAAAGTGGATTGGGG - Intronic
903809120 1:26024760-26024782 CCTCATCAGAAAAGTGAGGGAGG - Intronic
903993631 1:27290784-27290806 CCTCATCTGTAAAAGGAAAGAGG - Intronic
905562080 1:38935489-38935511 CATCATCTGTAAAAGGAGGGTGG + Intronic
905740359 1:40364988-40365010 CTTCATCTGAAACTGGGTTGTGG - Intronic
906884707 1:49631736-49631758 CCATATCTGAAAATGGATGGAGG + Intronic
907395129 1:54184419-54184441 CCTCATCTGAAAATTGGGAATGG - Intronic
907907543 1:58797960-58797982 TCTCATCTGAAAAGTGAATGTGG + Intergenic
908140024 1:61174525-61174547 TCTCATCTGGCATTGGAGTGGGG + Intronic
910703699 1:90104090-90104112 CCACATCTGAAAATGTTTTGGGG + Intergenic
912349288 1:108996758-108996780 CCTGATCTCAATATGGAGTCAGG - Intronic
912744285 1:112232249-112232271 CCACAGCTGCAAATGGAGAGTGG + Intergenic
914474394 1:148011485-148011507 CCACATCTCACTATGGAGTGAGG + Intergenic
918672998 1:187243999-187244021 ACTCAGCTGAGAATGGAATGGGG + Intergenic
919719080 1:200812417-200812439 CCTAATTTGAAAATGGAATGAGG - Intronic
920550767 1:206859000-206859022 CCTCCTCTGGAATTGGAGTTGGG - Intergenic
920705149 1:208244825-208244847 CTTCATCTGTAATTTGAGTGAGG + Intergenic
920950457 1:210567385-210567407 CCTCATCTGGAAATTAAGGGAGG + Intronic
921777945 1:219124784-219124806 CCTCACATGTAAATGGAGAGAGG - Intergenic
1065124943 10:22565209-22565231 TCTCAGCTGAAAAAAGAGTGTGG - Intronic
1065144829 10:22758163-22758185 TCTCTTCTGTAAATGGGGTGAGG - Intergenic
1065174625 10:23064418-23064440 TGTCATCTGAGAATGCAGTGGGG - Intergenic
1067488268 10:46673110-46673132 CCTTTTCTGAAAAGGGAGAGAGG - Intergenic
1067606535 10:47668918-47668940 CCTTTTCTGAAAAGGGAGAGAGG + Intergenic
1070722454 10:78765966-78765988 CCTCTTCTGAAAATCCAGGGAGG - Intergenic
1072325328 10:94292535-94292557 CCTCATCTGTAAGTGGGCTGTGG - Intronic
1072721373 10:97782931-97782953 TCTCATCTGTAAATGGAGTGGGG - Intergenic
1073834344 10:107423987-107424009 CTTCATCTGTAAAAGGATTGGGG - Intergenic
1074160133 10:110830060-110830082 CCTCACCTGAGAATGGAGGTAGG - Intronic
1075462715 10:122629255-122629277 CCTCATCAGAAAAATGAGAGTGG - Intronic
1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG + Intronic
1079535254 11:21506562-21506584 CCTCATCTGAAAATGGGACATGG + Intronic
1079899145 11:26159640-26159662 CCTTATCTGAATATGAATTGGGG + Intergenic
1080324089 11:31050128-31050150 CCTCATCTGCAAACGGACTCAGG + Intronic
1085260793 11:75203593-75203615 CCTCATCTATAAAAGGAGGGGGG - Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086244171 11:84731441-84731463 TCTCATCTAAAAATGGAGGTAGG + Intronic
1087155313 11:94896086-94896108 CCTCATCTGTAAATGATGGGTGG - Intergenic
1087701559 11:101441461-101441483 TCTCATCTCAAAATTGAGTTGGG + Intergenic
1089159809 11:116428733-116428755 CATCTTCAGAAACTGGAGTGGGG - Intergenic
1089914127 11:122135883-122135905 CCTCCTCTGAAAATAAAGAGTGG + Intergenic
1091036994 11:132243637-132243659 CCTTTGCTGAAAATGGAGTGAGG + Intronic
1092529413 12:9332104-9332126 TCTCAACTGAAACTGGACTGGGG + Intergenic
1095552912 12:43465358-43465380 CCTCATCTGTAAATTGAGAGTGG + Intronic
1095698307 12:45165134-45165156 ACTCATGTGAAAATGCTGTGTGG + Intergenic
1095846173 12:46747271-46747293 CCTGATACAAAAATGGAGTGGGG + Intergenic
1095871717 12:47035474-47035496 CCTCACCTGAAAACAGAGTTGGG - Intergenic
1097166709 12:57089902-57089924 CCGCATCTTCAAGTGGAGTGGGG - Intronic
1097374554 12:58825797-58825819 TCTCACTTGAAAATGCAGTGTGG - Intergenic
1101625763 12:106439753-106439775 CCTCATTTCAAAATTGACTGAGG + Intronic
1103831986 12:123787659-123787681 CCTCATCGGAAAAGGCAGAGCGG - Intronic
1106225439 13:27782876-27782898 TTTCTTCTGAAAATGTAGTGAGG + Intergenic
1106268368 13:28130430-28130452 ACTGATCTGATAGTGGAGTGAGG + Intergenic
1107088567 13:36451402-36451424 CCTCATCTCAAAAAAAAGTGAGG - Intergenic
1107282829 13:38756017-38756039 GCCCATCTGAGAATGCAGTGAGG + Intronic
1108007898 13:45970964-45970986 TCTCATCTGAAAATGGTGGGTGG + Intronic
1108186490 13:47893106-47893128 CCTCATCTGTAAAGTGAGTGAGG + Intergenic
1108232115 13:48356582-48356604 ACTAATCTGAAAATGGAGAGGGG - Intronic
1109768972 13:66944875-66944897 GCTTATCTTAAATTGGAGTGTGG - Intronic
1110716016 13:78705039-78705061 GCTTATCTGAGAATGGAGGGTGG + Intergenic
1111046140 13:82814963-82814985 GCTGATCAGAAAATAGAGTGTGG + Intergenic
1111180021 13:84651970-84651992 CCTCAAATGAGAAGGGAGTGCGG - Intergenic
1112993787 13:105547069-105547091 ACTATTCTGAAAATGGTGTGGGG - Intergenic
1115988941 14:39131459-39131481 CCCCATTTTAAAAGGGAGTGGGG + Intronic
1118467913 14:66047874-66047896 CCTCATTTTAAGAAGGAGTGAGG - Intergenic
1119376073 14:74194389-74194411 CCTGCTCTGAAAGTGGTGTGTGG - Intronic
1119902496 14:78273292-78273314 CCTTATCTGTAAAATGAGTGTGG + Intronic
1120613087 14:86666687-86666709 CTGAAGCTGAAAATGGAGTGGGG + Intergenic
1121622965 14:95362980-95363002 CCTCCCCAGAAAAGGGAGTGTGG + Intergenic
1121828228 14:97028039-97028061 CCCCATCTGAAAATGGAGGCAGG + Intergenic
1122146395 14:99691397-99691419 CCTCATCTGTAAACTGGGTGGGG + Intronic
1123114645 14:105889192-105889214 CCTCATCTTTAGAGGGAGTGCGG + Intergenic
1127100121 15:55555505-55555527 CCTTAAATGTAAATGGAGTGGGG + Intronic
1128113608 15:65092048-65092070 CCTCATCTGAATGTGTAATGGGG - Intergenic
1128163060 15:65437237-65437259 CCTCATCTGAAAGTGAGGGGAGG + Intergenic
1129227162 15:74176684-74176706 CCTCATCTGAGACTGAAATGTGG + Exonic
1129540549 15:76343887-76343909 CATCATCTGCAAGTGGGGTGGGG - Intergenic
1129558001 15:76533887-76533909 CCTCTTCTGAAAGTGAAATGTGG - Intronic
1130515028 15:84619792-84619814 CTTCATCTGAAAATGAGGTCAGG - Intronic
1130641013 15:85675594-85675616 TCTCATCTGTAAATGTGGTGAGG - Intronic
1133324710 16:4935982-4936004 CCACTTCGGAAAATAGAGTGGGG - Intronic
1133378577 16:5310515-5310537 CCTCATCTGTATATGGAGGAGGG + Intergenic
1135712001 16:24725548-24725570 CTTCACCTGAGAATGGAGAGAGG - Intergenic
1136145689 16:28315171-28315193 TCTCATCTGTAAATGGAGAGAGG - Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1137738572 16:50742549-50742571 CCCAATCTGTAAATGGGGTGGGG - Intronic
1138539782 16:57680738-57680760 CCTCATCCCAAAATGGGGTTGGG + Intronic
1138743943 16:59341539-59341561 TCTGATCTGAAAATGAAGTTAGG + Intergenic
1140723788 16:77793761-77793783 GCTGATCTGAAAATGGGCTGAGG + Intronic
1141344681 16:83233885-83233907 CCTCATCTATACAAGGAGTGTGG - Intronic
1141470653 16:84236199-84236221 CCTCATCTGAAAATGGAGTGGGG + Intronic
1141722641 16:85765317-85765339 CCTCAGCTGAGGATGGAGGGTGG + Intergenic
1142589626 17:996936-996958 CCTCTTGTGAAAATGGAATTGGG - Intergenic
1142904009 17:3031021-3031043 CCTCTGCAGAAAGTGGAGTGTGG - Intronic
1143455060 17:7061994-7062016 CCTCTTCTGAAAAAGGACTTTGG - Intergenic
1145091115 17:19986942-19986964 CCTTATTTAAAAATGGACTGGGG - Intergenic
1146563189 17:33889232-33889254 CTTCATCTGAAAAACGAGGGGGG - Intronic
1147442238 17:40454221-40454243 CCTCATCTCCAAAATGAGTGAGG - Intronic
1148908404 17:50926416-50926438 CCTCATCTGCAAAGTGATTGAGG + Intergenic
1149583107 17:57765172-57765194 CCTCATCTGACATTGGTCTGCGG - Intergenic
1149919651 17:60645023-60645045 CTTCTTCTGAAAATGTATTGAGG + Intronic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1151306572 17:73266512-73266534 GCTCATCTGTAAAAGGGGTGAGG - Intergenic
1153290070 18:3492426-3492448 CTTCATTTGAAGATAGAGTGAGG - Intergenic
1153782972 18:8510285-8510307 CATCATCTGGAACTGGAGTGGGG + Intergenic
1155209037 18:23585561-23585583 CCTCTTTTAAAACTGGAGTGGGG - Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159568085 18:70078887-70078909 ACTCATCTCAAAATGGGTTGGGG + Intronic
1162013739 19:7832473-7832495 CCCCATCGGAAACTGGGGTGCGG + Intronic
1163595852 19:18220703-18220725 CCTCATCTGTAATATGAGTGTGG + Intronic
1164434886 19:28220490-28220512 TCTCATGTGAAGACGGAGTGGGG - Intergenic
1164694974 19:30236623-30236645 CATCATCTAAAAATGGATTAAGG + Intronic
1164923539 19:32108012-32108034 CTTCAACTGACAATGCAGTGAGG - Intergenic
1167342150 19:48922301-48922323 CATCGTCTGGAAATGGAGGGAGG - Exonic
929420220 2:41782709-41782731 CCTTACCTGAAAATGCAGGGTGG + Intergenic
934908332 2:98226414-98226436 TCTTAACTCAAAATGGAGTGTGG + Intronic
935080281 2:99786247-99786269 CCTCATCTGTAAATGGGGACTGG + Intronic
936061716 2:109299097-109299119 CCTCATCTGCAAATGCCCTGGGG - Intronic
936444773 2:112586817-112586839 CCTCATCTGCAACTGCAGAGGGG + Intronic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
941002642 2:160218033-160218055 CCTCATTTCAAATTGGAGGGAGG + Intronic
941320580 2:164049406-164049428 CCTCATCGGCAAATGGTCTGAGG + Intergenic
945682179 2:212927263-212927285 ACTCTTCTGCAAATGGAGGGAGG - Intergenic
947010824 2:225564486-225564508 CCTCATCTGAATATAGAGAAAGG + Intronic
1168826588 20:818447-818469 CCTCATCTGTAGAATGAGTGAGG + Intergenic
1169616952 20:7458720-7458742 CCACATCTGAAAGTGGTCTGAGG - Intergenic
1173404115 20:42750105-42750127 CCTCTTCTGAAATGGGATTGAGG - Intronic
1173922965 20:46759564-46759586 CCCCATGTGTCAATGGAGTGAGG + Intergenic
1174116133 20:48227651-48227673 CCTCATCTGTAAGTGGTGGGTGG - Intergenic
1175989133 20:62778854-62778876 CCCCATCTGTAAATGGAGACAGG - Intergenic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1180181362 21:46120012-46120034 CCTCAGCAGAGAATGGGGTGTGG - Intronic
1180904363 22:19398274-19398296 CTTCGTCTGTAAAAGGAGTGAGG - Intronic
1182294528 22:29305313-29305335 CCTCATCAGGAAAGGAAGTGAGG - Intergenic
1182413481 22:30206121-30206143 CCTCATCTGTAAATGGAGGCGGG - Intergenic
1183061900 22:35341322-35341344 TCTCATCTGTAAATGGGATGAGG - Intronic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
949589496 3:5479142-5479164 TCTCACGTGTAAATGGAGTGAGG - Intergenic
950499961 3:13357552-13357574 CCTCCTCTGAAAAGGGGCTGGGG + Intronic
952219700 3:31312809-31312831 CCTAATATGAAGGTGGAGTGGGG - Intergenic
952390110 3:32872786-32872808 CCTCACCTGGAGATGAAGTGTGG + Intronic
953412830 3:42699820-42699842 CCCCATCTGAGAACAGAGTGTGG + Exonic
954045372 3:47925278-47925300 CCTCAGCGGAAAGTTGAGTGTGG - Intronic
955063182 3:55511916-55511938 CCTCATCTGAAGCAGTAGTGTGG - Intronic
955727383 3:61947860-61947882 CCTCCTCTGAAAAAGGAGGCAGG - Intronic
957131380 3:76226480-76226502 TCTTATCTGAAAATCGAGTAAGG + Intronic
957226996 3:77462215-77462237 CCTCAACAGAATATTGAGTGAGG - Intronic
959021794 3:101195529-101195551 CCTCATCTGTAAATGGGGGCTGG - Intergenic
961622606 3:128236400-128236422 CCTCATCTGTAAATGGCGGGGGG + Intronic
966751404 3:183325412-183325434 CCACTTCTGAAAATGGTTTGGGG + Intronic
966815276 3:183885080-183885102 CCTCATCTGCAAATGCCGGGAGG - Intergenic
967232040 3:187348558-187348580 AGTCAACTGAAAATGGAGTAAGG - Intergenic
967366753 3:188695606-188695628 CTTCACCTGTAAATGGAGTTGGG - Intronic
967520437 3:190425166-190425188 CCTGCTCTGTAAATGGAATGGGG + Intergenic
967805384 3:193710971-193710993 CCTCCTCTGAAAATGAAAGGGGG - Intergenic
969296964 4:6275946-6275968 CCTCATCTGAAAATGGGGACGGG - Intronic
969900842 4:10347922-10347944 CCTCATTTGGAAATGGGCTGAGG + Intergenic
970444899 4:16115383-16115405 CATCATCTGAATATGGCGGGGGG + Intergenic
970602017 4:17648023-17648045 CCTCATCCTAAAATGAAGCGGGG - Intronic
970735921 4:19167753-19167775 TTTTATCTGAAAATGGAGAGAGG + Intergenic
973897937 4:55434926-55434948 CATTATCTGAAAAGGGAGAGGGG + Exonic
975579331 4:75892476-75892498 CCTCATCTGGAAAAGGGGCGGGG + Intronic
975693851 4:76992534-76992556 TCTCATCTGTAAATTGAGTTTGG + Intronic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
977048358 4:92094964-92094986 CTACATCTGAAAATTCAGTGTGG - Intergenic
978156556 4:105495798-105495820 CCTAATCTGAACCTGGAGTTTGG + Intergenic
982143935 4:152361268-152361290 CCTCTTTTTAAAATGTAGTGGGG - Intronic
982420535 4:155191271-155191293 CTTCACCTGAAAATGAAATGTGG - Intergenic
984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG + Intronic
984706745 4:182852769-182852791 CCCCATCTGGAAATGGAGCAGGG - Intergenic
985299045 4:188468154-188468176 ACTCTTCTTAAAATGGACTGTGG + Intergenic
987242127 5:16010910-16010932 TTTCATCTGAAACTGGGGTGGGG + Intergenic
987839805 5:23209016-23209038 CCTCCTCTGAAAATGAAGCTGGG + Intergenic
988434768 5:31161183-31161205 TCTCATCTGAAAATTTAGTGGGG - Intergenic
992018036 5:72595449-72595471 CTTCATCTTAAAATTCAGTGGGG - Intergenic
992029319 5:72705301-72705323 CCTCATTGGAAAGTGGAGTTGGG - Intergenic
992916797 5:81463397-81463419 CCTCATTTAAAAATGAAGAGAGG + Intronic
992996978 5:82343821-82343843 CATCAACTGAAAAGAGAGTGAGG - Intronic
993929459 5:93920310-93920332 CCTCATCTGAAAAGGGAAGATGG - Intronic
994174810 5:96700072-96700094 TCTCATCTGTAATAGGAGTGAGG + Intronic
994855958 5:105119209-105119231 CCTGATATGGAAATGGAGTCAGG - Intergenic
995532134 5:113102104-113102126 CCTCATCTGAAATTGGAGACAGG - Intronic
995812009 5:116117937-116117959 CCTAAAATGGAAATGGAGTGGGG - Intronic
995834032 5:116382834-116382856 CCTGGTCAGAAAGTGGAGTGGGG - Intronic
998562724 5:143186354-143186376 CCCCATGTGGAGATGGAGTGGGG - Intronic
998649675 5:144103994-144104016 CCTCATTTACAAATGAAGTGAGG - Intergenic
999069464 5:148728464-148728486 CCTCTTCTGTATATGCAGTGTGG - Intergenic
999300858 5:150489524-150489546 CCTCATCTGAAAATGGGGCAGGG - Intronic
999925790 5:156375344-156375366 CAAAATCTGAAAATGGACTGTGG - Intronic
1001286995 5:170431044-170431066 CAGCATCTGCAGATGGAGTGAGG - Intronic
1004004156 6:11623565-11623587 CTTCATCTCAAAATTGAGTCTGG - Intergenic
1004887067 6:20061357-20061379 AGTCATCTGAAAATTGACTGGGG - Intergenic
1005848319 6:29800315-29800337 CCTGAACTGAAAATGGAATCGGG - Intergenic
1005868523 6:29956478-29956500 CCTGAACTGAAAATGGAATCCGG - Intergenic
1006395561 6:33784911-33784933 CCTCATCTGAGTAAGGATTGTGG + Intronic
1006830734 6:36966690-36966712 CCTCATCTGAGAAAGGAGATTGG - Intergenic
1007188516 6:39993925-39993947 CATCCTCTGAAAAGGGAGTCTGG + Intergenic
1007816448 6:44528614-44528636 CCTGAACTGATAATGGAGTCTGG - Intergenic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1011761945 6:90576730-90576752 CCTTGTCTAAAATTGGAGTGAGG - Intronic
1012104001 6:95129472-95129494 CCTCATTTCAAAATGGGGAGTGG - Intergenic
1012699759 6:102440176-102440198 CTTCATCTGTAATTGGATTGGGG - Intergenic
1013046577 6:106491647-106491669 CCACATATGGAAATGGAGGGAGG - Intergenic
1017476224 6:154796545-154796567 CCTAATTTGAAAATAGAGTAGGG - Intronic
1018621758 6:165735516-165735538 GCTCATCTGATTATGGAGGGTGG + Intronic
1019002912 6:168770546-168770568 GCTCATCTGGAAATTGATTGAGG - Intergenic
1020844364 7:13263846-13263868 TCTTATCTGAATATGGACTGAGG - Intergenic
1021256726 7:18401357-18401379 CCTCATTTGAAGATGCAGTTGGG + Intronic
1023200103 7:37687777-37687799 GGTCATCTGAAAATGGAGCTTGG - Intronic
1024542856 7:50493112-50493134 CCTCATCTGTAAAGAGAGCGTGG + Intronic
1028633846 7:92965224-92965246 CCTTATCTGTAAATGGTGTGGGG + Intergenic
1028983239 7:96989847-96989869 CCTCAACTGGAAAAGGAGTTGGG + Intergenic
1029184237 7:98727176-98727198 CATCATTTGAATATGGGGTGGGG + Intergenic
1029439494 7:100579107-100579129 GATCATTTGAAAATGGAGGGTGG - Intronic
1030221298 7:107101916-107101938 CCTCATCTCAAAAGGCAATGAGG - Intronic
1032706318 7:134423647-134423669 CTTCATCTGAGAATGGAATGTGG - Intergenic
1033403418 7:141049084-141049106 CCAAGTCTGAAAATGGGGTGGGG - Intergenic
1037611757 8:20481814-20481836 CCACATATGAAATTGGGGTGGGG - Intergenic
1038087868 8:24219861-24219883 CCTAATCTAGAAATGGGGTGAGG - Intergenic
1038422192 8:27440436-27440458 CCTCAGGTGAGCATGGAGTGTGG + Exonic
1039762227 8:40590025-40590047 CCTCATCTAAAAAGGAAGGGAGG - Intronic
1039925869 8:41931954-41931976 ACTCATCTAAAAATGGATTTGGG - Exonic
1040794533 8:51274420-51274442 CCTTATCTGAAAAAGGATTCTGG - Intergenic
1041759950 8:61355259-61355281 CTTCCTCTTAAACTGGAGTGAGG - Intronic
1043111454 8:76188516-76188538 CCTCTTCTGAAAATGGTGACAGG + Intergenic
1043674376 8:82931916-82931938 CATCATATGTAAATGGAGTGGGG + Intergenic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044694454 8:94908972-94908994 CCTCTTTTGAAAAATGAGTGAGG - Intronic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1045698487 8:104838284-104838306 ACAAATCTGAAAACGGAGTGGGG - Intronic
1047291121 8:123531399-123531421 CCTCATCTGAGAATGCCTTGGGG + Intronic
1047725402 8:127679828-127679850 GCTCCTCTGAAAATGCAGCGGGG + Intergenic
1048882749 8:138883917-138883939 CCTCATCTGAATATGGCATGAGG + Intronic
1049310324 8:141930761-141930783 CCTCATCTGTAGATGCAGGGTGG - Intergenic
1050376382 9:4977874-4977896 CCTCATCTCAAAAGAAAGTGAGG - Intergenic
1051089470 9:13389251-13389273 TCTCATCTCAAAATGGAGCAGGG + Intergenic
1051868357 9:21707870-21707892 CCTCATCTGAGAATAGATGGAGG + Intergenic
1052083098 9:24230790-24230812 CTTCTTTTGAAAATGCAGTGTGG + Intergenic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1056343193 9:85659550-85659572 CCTCATTTGAAAAAGAAGGGAGG + Intronic
1057279376 9:93698945-93698967 CCTCATCTTAAAAAGATGTGGGG + Intergenic
1057705052 9:97390042-97390064 GCTCAGCTGAAATGGGAGTGGGG - Intergenic
1057849591 9:98555011-98555033 CCTCCTCTGTAAATGGACTGGGG + Intronic
1058151597 9:101469507-101469529 GCTGATCTGCAAATGGAGAGAGG - Intergenic
1058886013 9:109321323-109321345 CCTCTTCTGGAAAAGGAGAGGGG + Intergenic
1059591421 9:115666862-115666884 CCTCATCTGTAAATTGTATGGGG + Intergenic
1059756023 9:117294082-117294104 TCTCATCTGAACATGGAAAGGGG - Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1060825361 9:126684589-126684611 CCACACCTGAAGATGGAGTAGGG + Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061509595 9:131052566-131052588 CCTCAGCTGTACAGGGAGTGGGG - Exonic
1061596011 9:131629468-131629490 CCTCATCTGAAAATGATCTAAGG + Intronic
1186174054 X:6906697-6906719 CCCCAGCTGAAATTGGACTGGGG - Intergenic
1187025268 X:15428866-15428888 GCTCATCTGAAAATTTTGTGAGG + Intronic
1188317732 X:28695274-28695296 CCTCCTCTGTAAATGATGTGAGG - Intronic
1188875012 X:35418744-35418766 CCTCATCTGCAAATGAGGTCTGG - Intergenic
1190019254 X:46857663-46857685 CATCATCTGAAATTGAAGTTGGG + Intronic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1190979070 X:55439792-55439814 CCTCATCTGGAAATGGGTAGAGG - Intergenic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192230908 X:69264354-69264376 CCGCATCTGCATATGGAGTCAGG - Intergenic
1193431293 X:81409424-81409446 CCTCAACTGTAAAAGGAGAGTGG + Intergenic
1194179800 X:90697499-90697521 ACTCACCTGAAAATTGATTGAGG + Intergenic
1195175842 X:102314746-102314768 CATGATCTGAAAAGGGACTGTGG + Intronic
1195183022 X:102372347-102372369 CATGATCTGAAAAGGGACTGTGG - Intronic
1199323052 X:146463589-146463611 CCTCACCCCAAAATGTAGTGAGG + Intergenic
1199711929 X:150475720-150475742 CCTCAGCTGAAAATGGGGAAAGG + Intronic
1200240283 X:154489807-154489829 CGTCATCTGAGACTGGGGTGAGG + Intronic
1200526456 Y:4279668-4279690 ACTCACCTGAAAATTGATTGAGG + Intergenic
1201499177 Y:14623420-14623442 CCTCATCTAAAAATGGCATATGG - Intronic
1201560347 Y:15309715-15309737 CTTCAGCTGGAACTGGAGTGAGG + Intergenic
1201594275 Y:15650487-15650509 CCTCATCAAAAAATGGTGTCTGG + Intergenic