ID: 1141470808

View in Genome Browser
Species Human (GRCh38)
Location 16:84237122-84237144
Sequence CAGGAGCCCCAGCGCCTTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141470808_1141470811 -5 Left 1141470808 16:84237122-84237144 CCCCGAAGGCGCTGGGGCTCCTG 0: 1
1: 0
2: 1
3: 15
4: 176
Right 1141470811 16:84237140-84237162 TCCTGTCGAAGAAGAACTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141470808 Original CRISPR CAGGAGCCCCAGCGCCTTCG GGG (reversed) Exonic
900556601 1:3283886-3283908 CAGGAGCCCAGGTGCCTCCGCGG + Intronic
901081970 1:6588701-6588723 CAGGAGCCCCGGGACCCTCGAGG - Intronic
904402734 1:30267310-30267332 CAGGCCCCCCAGCCCCTTAGAGG - Intergenic
904597360 1:31655347-31655369 CTGGAGCTCCGGGGCCTTCGGGG - Exonic
904928539 1:34067507-34067529 CAGGAGCCCCAGGGGCTGCCAGG + Intronic
911902737 1:103525740-103525762 CAGGAACCCCAGCCACTTCAGGG - Exonic
914870968 1:151473476-151473498 CGCGGGCCCCCGCGCCTTCGCGG - Intergenic
918081638 1:181212223-181212245 CAGGTGCCCCAGGGACTTAGGGG + Intergenic
919653962 1:200179958-200179980 CAGGATCCCCAGTGCCTTCTGGG - Intergenic
919809535 1:201399808-201399830 CTAGAGCGCCCGCGCCTTCGGGG + Intergenic
921010133 1:211133481-211133503 CGGGAGCCCCAGAGCCTTCGCGG + Intronic
921944887 1:220879689-220879711 CGGGAGCCCTAGCGCCACCGAGG - Exonic
1062910169 10:1206955-1206977 CAGCAGCCCCGCTGCCTTCGCGG - Intronic
1063663882 10:8050648-8050670 CCGGAGCCCCGGCGCCTGCCTGG - Intergenic
1075498801 10:122953812-122953834 CAGGAGCCTCGGCCCCTTCCCGG + Intronic
1075504222 10:123008452-123008474 CAGGAGACCCCGCTCCCTCGGGG + Intronic
1076121918 10:127943401-127943423 ATGGAGCCCCAGTGCCTTCCAGG - Intronic
1076248000 10:128962364-128962386 GAGCAGCCCCATCTCCTTCGAGG - Intergenic
1076741551 10:132488239-132488261 CAGGAGTCCCAGCTCCATCCAGG + Intergenic
1080040103 11:27750935-27750957 CATGAGCCCCACTGCCTTCATGG + Intergenic
1084646206 11:70460094-70460116 CTGGAACCCCAGGGCCTTTGTGG - Intergenic
1085485426 11:76859766-76859788 CAGGTGACCCAGCGCATTCTAGG + Intergenic
1087910870 11:103752054-103752076 CAGGAGCCCCAGCCCTTCCTTGG + Intergenic
1088172703 11:107017321-107017343 AAGGAGCCCCAACCCCTTCCAGG - Intronic
1090277939 11:125432611-125432633 CAGGAGCCCCAGTTCCTCCAGGG - Exonic
1096194902 12:49643461-49643483 CACAAGCCCCAGCTCCTTTGAGG + Exonic
1096431058 12:51543349-51543371 GGGGAGCCCAAGCGCCTTCTGGG + Intergenic
1100391636 12:94149618-94149640 GAGGCGCCCCAGCTCCTGCGTGG - Exonic
1103115066 12:118321381-118321403 CAGTAGCCCCAGCTTCTTAGAGG - Intronic
1103569100 12:121832305-121832327 CAGGAGCCCCAGCCCCAGAGTGG + Exonic
1103826844 12:123745751-123745773 CAGGACCCCCAACCCCTTCGAGG + Intronic
1104730843 12:131104532-131104554 CAGGAGGCTCAGCGCCTGCCCGG + Intronic
1104785637 12:131446413-131446435 CAGGTGCCCCAGCCCCGTGGAGG - Intergenic
1106079430 13:26488095-26488117 CAGGTGGCCCAGCTCCTTCCAGG + Intergenic
1106132316 13:26950731-26950753 CAGGTGACCCAGAGCCTTCTCGG - Intergenic
1113334946 13:109368686-109368708 AAGGAGACCCAGCGTCTTCTTGG - Intergenic
1114241624 14:20873842-20873864 CCGCAGGCCCAGAGCCTTCGTGG - Intergenic
1114658641 14:24331057-24331079 CATGAGCACCAGCTCCTTAGGGG + Exonic
1118312617 14:64704780-64704802 CTGGGGCCCCAGTCCCTTCGCGG + Intronic
1122089866 14:99330959-99330981 CAGGAGCCCCACAGCATTCGAGG + Intergenic
1122269211 14:100560873-100560895 CACGAGCCCCAGAGCCTCGGTGG + Intronic
1122488071 14:102094967-102094989 CAGGAGCCCCAGAGGCTCCCGGG + Intronic
1123061366 14:105596193-105596215 CTGGGGCCCCAGAGCCATCGGGG - Intergenic
1123085820 14:105717104-105717126 CTGGGGCCCCAGAGCCATCGGGG - Intergenic
1125882791 15:43208547-43208569 CAGGAGCCCCACCCCCTGCATGG - Intronic
1129996430 15:80010211-80010233 CAGTAGTCCCAGCGCTTTGGGGG - Intergenic
1131292454 15:91118519-91118541 CAGGAGCCCCAGGGCTGTCCAGG + Intronic
1132552868 16:560540-560562 CCAGAGCCCCAGCGCGTCCGCGG + Exonic
1132670670 16:1101031-1101053 CAGGAGCCCCCGGGCCTCAGAGG - Intergenic
1132976659 16:2714390-2714412 GAGGAGCCCCAGCCCCTCCCGGG - Intronic
1134843041 16:17416607-17416629 CAGGAGCCGCAGCTCCTCCAGGG - Intronic
1136536437 16:30902439-30902461 GCGGAGCCCCAGCACCTTGGCGG - Exonic
1137686701 16:50391589-50391611 TGGGAGCCACAGCGCCCTCGTGG + Intergenic
1138474368 16:57262056-57262078 CAGCAGCCCCAGCACCTAGGAGG + Exonic
1139433797 16:66925106-66925128 CAGGAGCGCGAGCGCCGTCGGGG - Exonic
1139612028 16:68066100-68066122 CTGGAGCCCCAGCACCTGCCTGG - Intronic
1139853709 16:69965232-69965254 CAGGGGGCTCAGCGCCTTCGCGG - Intergenic
1139882687 16:70188145-70188167 CAGGGGGCTCAGCGCCTTCGCGG - Intergenic
1140369823 16:74407374-74407396 CAGGGGGCTCAGCGCCTTCGCGG + Intergenic
1141470808 16:84237122-84237144 CAGGAGCCCCAGCGCCTTCGGGG - Exonic
1141939522 16:87265553-87265575 CTGGAGCCCCAGAGTCTTCTAGG + Intronic
1142185714 16:88693876-88693898 CAGGAGCCCCAGCTCCTCCAGGG + Intergenic
1142272208 16:89095992-89096014 GAGAAGCCCCAGTGCCTTAGTGG + Intronic
1142361893 16:89631242-89631264 CAGGTGCCCCAGCGAGGTCGGGG - Intronic
1143579521 17:7817494-7817516 CAGCAGCCCCCGCGCCTTCACGG - Intronic
1143644891 17:8223692-8223714 CACGTGCCTCAGAGCCTTCGGGG - Intergenic
1144888129 17:18477729-18477751 CAGGAGCCCAGGAGCCTTCAGGG + Intronic
1145144076 17:20466574-20466596 CAGGAGCCCAGGAGCCTTCAGGG - Intronic
1147157699 17:38552498-38552520 GAGGAGCCCCAGCGCCTGGATGG - Exonic
1147285808 17:39401835-39401857 CACGACCCCCTGCGCCTCCGAGG + Intronic
1147473289 17:40684758-40684780 CTGGAGACCCAGCTCCTTCAAGG - Intergenic
1148074651 17:44928393-44928415 GAGGAGACCAAGCGCCTTGGAGG - Exonic
1148344093 17:46891792-46891814 CAGGAACCCCAGAGCTTTCTTGG + Intergenic
1148591743 17:48821362-48821384 CTGGAGCCCCAGCTACTTGGAGG + Intergenic
1151542810 17:74773440-74773462 CAGGAGTTCCAGCACCTTCCAGG + Intronic
1151756880 17:76080211-76080233 CCAGAGCCCCAGCCCCTTCTTGG - Intronic
1151842396 17:76627533-76627555 CTGGAGCCACAGCGACTTGGAGG + Exonic
1151969189 17:77449178-77449200 GAGCAGCCCCAGAGCCTTCTCGG - Intronic
1152190639 17:78885447-78885469 CAGGAGCCCCACACCCTTCCGGG + Intronic
1152725219 17:81941772-81941794 CAGGGACCCCAGGGCCTTGGGGG - Exonic
1152906577 17:82973840-82973862 TAGCAGCCCCAGCGCCATTGTGG - Intronic
1155498835 18:26467391-26467413 CTGCAGCCCCAGCTACTTCGGGG + Intronic
1156553132 18:38039626-38039648 CAGGAGCCCCAGTGCCTTGTGGG + Intergenic
1157337855 18:46754790-46754812 CAGCAGCCCCAGCAACTTTGGGG + Intronic
1157622988 18:49026826-49026848 CAGGAGCCCCATCGCCATGTTGG - Intergenic
1158867585 18:61652694-61652716 CAGGAGCCCCATGGCCATCAAGG - Intergenic
1160411659 18:78679187-78679209 CAAGAGATCCAGCGCCTGCGAGG + Intergenic
1160789466 19:916976-916998 CTGGAGCCCCAGCCCCTACGAGG + Intergenic
1160803887 19:982967-982989 CAGGAGTCGCACCGCCTCCGGGG + Intergenic
1161070106 19:2255758-2255780 CAGGTGCCCCAGCCCCTCCCAGG + Intronic
1161312027 19:3600137-3600159 CAGCAGGCCCAGCGCCAGCGCGG + Exonic
1162944124 19:14032020-14032042 CTGGAGCACTGGCGCCTTCGCGG - Intronic
1164992053 19:32691873-32691895 CAGGGACCCCAGCACCTCCGGGG - Intergenic
1165573870 19:36797521-36797543 CTGCAGACCCAGCGCCTGCGGGG - Intergenic
1165831353 19:38732046-38732068 GAGGGGCTCCAGCGCCTTCTCGG - Intronic
1166599429 19:44081052-44081074 CAGCAGCCCCAGCTCCTCCTCGG - Exonic
1166712287 19:44945137-44945159 TAGGAGCCCGAGCACCTTCCGGG + Exonic
1167005720 19:46775371-46775393 CAGGGGCCCCAGCACCCTCCAGG - Exonic
1167166455 19:47802907-47802929 CAGCAGCCCCAGCGCGTCCCTGG - Exonic
1167175388 19:47860853-47860875 CAGCAGCCCCAGCGCGTCCCTGG + Intergenic
925309792 2:2874483-2874505 CAGGAGCCCCAGGGCCTGGAGGG - Intergenic
926163040 2:10501624-10501646 GAGGAGCCCCGGGGCCATCGGGG - Intergenic
931721909 2:65072728-65072750 CAGGATCCCCAGATCCTTGGAGG - Exonic
932325147 2:70854455-70854477 AATGAGCCCCAGCCCCTTAGAGG + Intergenic
934567083 2:95346940-95346962 CAGGGGCCCCGGTGCCTCCGAGG + Intronic
934844408 2:97653192-97653214 CTGTAGCCCCAGCACCTTGGAGG + Intergenic
935956634 2:108383409-108383431 CAGGAGCCCCAGCACACTGGAGG - Exonic
936458299 2:112692500-112692522 CAGCAGCCCCACCTCCTTCCAGG + Intergenic
937928728 2:127188262-127188284 CTGGAGCCCCAGCCCATTCTGGG - Intronic
942499977 2:176579224-176579246 CAGAAGCCCCAGAGGCTTCTGGG - Intergenic
948663314 2:239519914-239519936 CTGCAGCCCCAGCACCTTCATGG - Intergenic
1169139848 20:3221595-3221617 CAGGACCACCAGCACCTCCGGGG - Intronic
1172278330 20:33693485-33693507 CAGCATCCCCAGCACATTCGAGG + Intergenic
1173245658 20:41335722-41335744 CAGGAGCCCCATAGTCTTAGAGG - Intergenic
1174101051 20:48126426-48126448 CAGCAGCACCAGCTCCTTCCTGG + Intergenic
1175844420 20:62051153-62051175 CCTCAGCCCCAGCGCCTGCGGGG - Intronic
1176024103 20:62977185-62977207 CTGGAGCCCCCGTGGCTTCGGGG - Intergenic
1177751982 21:25296057-25296079 CAGGAGCCCCTGGGCTTTCATGG + Intergenic
1179973625 21:44850516-44850538 AAGGAGCACCAGCGCCTGCTGGG + Exonic
1180079026 21:45477910-45477932 AAGGACCCCCAGGGCCTCCGGGG + Exonic
1180155449 21:45975153-45975175 CAGAAGTCCGAGTGCCTTCGGGG - Intergenic
1180568363 22:16694636-16694658 CAGGATGACCACCGCCTTCGAGG + Intergenic
1180921386 22:19523280-19523302 CAAGACCCCCAGCGTCTTGGAGG + Exonic
1181802365 22:25355959-25355981 GAGGAGCCTCAGCACCTTCAGGG - Intronic
1182774146 22:32818651-32818673 CAGGAGGCCCAGCGCCGGAGGGG - Intronic
1183412359 22:37662382-37662404 CAGGAGGCCCAGAGCATTTGGGG + Intronic
1183748168 22:39704173-39704195 CAGGACCCCCAGCTCCCTCCTGG - Intergenic
1183931417 22:41238041-41238063 CAGGGGCCGCGGCGCCTGCGGGG - Exonic
1184662448 22:45971635-45971657 GAGAAGCCGCAGCGACTTCGGGG + Intronic
1185324051 22:50216990-50217012 CAGCGTCCCCAGCGCCTTCCAGG - Exonic
949709901 3:6861278-6861300 CAGGAGCCCCTGGGCTTTCCCGG + Exonic
954274276 3:49532305-49532327 CAGGAGCCCTATCCCCTTGGGGG - Exonic
966201384 3:177362117-177362139 CAGGAGGACCAGCCCCTTAGAGG - Intergenic
969179146 4:5424009-5424031 CAGGTGCCCCTGAGCCTACGGGG - Intronic
982080192 4:151782076-151782098 CAGGAGCTCCAGGTCCTTCTTGG - Intergenic
983061491 4:163166410-163166432 CAGGAGCCGCAGAGCCTGCGCGG - Exonic
983541075 4:168910941-168910963 TAGGAGCCCCAGCAGCTTGGCGG - Intronic
984883383 4:184429411-184429433 CAGAGGCCCCAACGCCTTTGGGG + Intronic
985920179 5:2965135-2965157 CAGGAACCCCAGCTCTTTCATGG - Intergenic
988801376 5:34699352-34699374 CAGCAGCCTCAGCTCCTTCTGGG + Intronic
997459054 5:134039991-134040013 CAGGAGCTCCTGCGCCTAAGGGG - Intergenic
998366494 5:141636110-141636132 CTGGAGCCCTAGCTCCTTGGAGG + Intronic
1000989542 5:167897954-167897976 CATGAACTCCAGCCCCTTCGTGG + Intronic
1001383266 5:171317767-171317789 CAGGCACCCCAGGGCCTTTGAGG - Intergenic
1002098702 5:176846815-176846837 CAGCAGCCCCAGCTCCCTCCGGG - Intronic
1002640805 5:180629783-180629805 CAGCAGCTCCAGCGACTTCCTGG + Exonic
1006133086 6:31880319-31880341 CAGGATCCACAGGGTCTTCGGGG - Intronic
1016776499 6:147910268-147910290 CAGGAGCCCTAGCACCTGGGTGG - Intergenic
1017543468 6:155426716-155426738 CAGGATCCCCAGGGCCTCCCTGG - Intronic
1018174457 6:161166904-161166926 CAGGAGCCCCAGCACCTGCAGGG + Intronic
1018198464 6:161375178-161375200 CAGGAGCCTCAGCACCCCCGGGG - Intronic
1021231060 7:18086744-18086766 CGGGAGCCCCAGCGCCGCGGAGG - Intergenic
1021626261 7:22595815-22595837 CAGGAGGCCCAGGGCCTTTAGGG + Intronic
1023571222 7:41574217-41574239 CTGGAGCCCCAAAGCCTTTGAGG + Intergenic
1023865139 7:44234878-44234900 CAGGAGCCCCAGGGTCATGGAGG - Intronic
1023913132 7:44569300-44569322 CAGGGGACCCACCGCCTTCCTGG + Intronic
1024235568 7:47394968-47394990 GAGGAGCCCCAGCTCCTGTGAGG - Intronic
1025233168 7:57216527-57216549 CAGCAGCACCAGCTCCTTCCTGG - Intergenic
1025613212 7:63096257-63096279 CTGGAGCCCCACCGCTTTCCTGG - Intergenic
1029665395 7:101991936-101991958 CTGGAGTCCCAGCTCCTTGGGGG + Intronic
1032257386 7:130308177-130308199 TAGGAGCCCCAGGGCCCTCCTGG + Intronic
1035042774 7:155942699-155942721 CCGGAGCCCCAGTGCCCTGGTGG + Intergenic
1036649438 8:10632984-10633006 GAGGAGCACCAGTGCCTTGGGGG + Intronic
1036784704 8:11678358-11678380 CAGCAGCCCCACCGGCTTCCAGG + Intronic
1038753254 8:30316428-30316450 CTGGAGACCCAGGGCCTTCTGGG + Intergenic
1040335172 8:46412450-46412472 CAGAAGCCCCAGGGTCTTCCCGG + Intergenic
1040341742 8:46444537-46444559 CAGAAGCCCCAGGGCTTTCCTGG - Intergenic
1042663089 8:71177439-71177461 GAGGAGCCCTAGAGCCTGCGGGG + Intergenic
1047343992 8:124009703-124009725 CAGCAGCACCAGCTCCTTCCTGG - Intronic
1048972078 8:139650802-139650824 CAGCAGCCCCATGGCCTTCAGGG + Intronic
1049479959 8:142817910-142817932 AGGGAGGCCCAGCGGCTTCGGGG + Intergenic
1049585273 8:143430091-143430113 CGGGGGCCCCGGCGCCGTCGGGG - Exonic
1049586672 8:143435622-143435644 CGGGAGCGCCAGCACCTTCCTGG - Intergenic
1049677837 8:143900667-143900689 CAGGAGCCCCAGCCCCACCCTGG - Intergenic
1053391607 9:37740238-37740260 GAGGGGCCCCAGCACCTGCGGGG + Exonic
1055668295 9:78573930-78573952 CGGGAGCACCACCACCTTCGAGG + Intergenic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1057565742 9:96164495-96164517 AAGCAGCACCAGAGCCTTCGGGG - Intergenic
1058112672 9:101048245-101048267 CAGGAGCCCCAGTGTTTTCTTGG - Intronic
1059565777 9:115381987-115382009 CAGGAGTCCCACTGCCTTCCTGG + Intronic
1059800438 9:117745012-117745034 CTGGAGCGCCCGCGCCTTCGCGG + Intergenic
1060479287 9:124008673-124008695 CGGGAGCCCCGCAGCCTTCGGGG + Intronic
1061129734 9:128702375-128702397 GAGGAGGCCCAGCGCGTTAGAGG + Intergenic
1061781650 9:132999781-132999803 CTGGAGCCCCAGGACCTTCCAGG - Intergenic
1062206790 9:135341922-135341944 CAGGAGCCCTGGCTGCTTCGAGG - Intergenic
1062436951 9:136550603-136550625 CAGGAGGCCCAGTGCCTGCCCGG - Intergenic
1062546420 9:137065541-137065563 CAGGAGCGCCAGCGCCGCCTGGG - Exonic
1191980047 X:66915640-66915662 CAGGAGACTCAACGCCTTCCTGG + Intergenic
1195351854 X:104004056-104004078 CAGGAGCCGCAGGGCCTTCATGG - Intergenic
1200055472 X:153457717-153457739 CAGGAGCAGCAGCTCCTGCGGGG + Intronic
1200097653 X:153671756-153671778 CAGGTTCCCCAGAGCCTTGGTGG + Intronic
1200226819 X:154422132-154422154 CAGGACCCCCAGCTCCATCTGGG - Intergenic
1201706053 Y:16938310-16938332 CAGGAGACCCAGCTTCTTAGGGG - Intergenic