ID: 1141473854

View in Genome Browser
Species Human (GRCh38)
Location 16:84258701-84258723
Sequence GTCTGTGTGGACCAAAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141473854_1141473866 14 Left 1141473854 16:84258701-84258723 CCCTCCCTTTGGTCCACACAGAC No data
Right 1141473866 16:84258738-84258760 AAATGGAGAACCCTTGGGGTAGG No data
1141473854_1141473872 28 Left 1141473854 16:84258701-84258723 CCCTCCCTTTGGTCCACACAGAC No data
Right 1141473872 16:84258752-84258774 TGGGGTAGGGAAGGAGGTCAAGG No data
1141473854_1141473863 8 Left 1141473854 16:84258701-84258723 CCCTCCCTTTGGTCCACACAGAC No data
Right 1141473863 16:84258732-84258754 ACTGAGAAATGGAGAACCCTTGG No data
1141473854_1141473868 19 Left 1141473854 16:84258701-84258723 CCCTCCCTTTGGTCCACACAGAC No data
Right 1141473868 16:84258743-84258765 GAGAACCCTTGGGGTAGGGAAGG No data
1141473854_1141473864 9 Left 1141473854 16:84258701-84258723 CCCTCCCTTTGGTCCACACAGAC No data
Right 1141473864 16:84258733-84258755 CTGAGAAATGGAGAACCCTTGGG No data
1141473854_1141473865 10 Left 1141473854 16:84258701-84258723 CCCTCCCTTTGGTCCACACAGAC No data
Right 1141473865 16:84258734-84258756 TGAGAAATGGAGAACCCTTGGGG No data
1141473854_1141473869 22 Left 1141473854 16:84258701-84258723 CCCTCCCTTTGGTCCACACAGAC No data
Right 1141473869 16:84258746-84258768 AACCCTTGGGGTAGGGAAGGAGG No data
1141473854_1141473867 15 Left 1141473854 16:84258701-84258723 CCCTCCCTTTGGTCCACACAGAC No data
Right 1141473867 16:84258739-84258761 AATGGAGAACCCTTGGGGTAGGG No data
1141473854_1141473860 -3 Left 1141473854 16:84258701-84258723 CCCTCCCTTTGGTCCACACAGAC No data
Right 1141473860 16:84258721-84258743 GACCCAGAAGGACTGAGAAATGG No data
1141473854_1141473873 29 Left 1141473854 16:84258701-84258723 CCCTCCCTTTGGTCCACACAGAC No data
Right 1141473873 16:84258753-84258775 GGGGTAGGGAAGGAGGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141473854 Original CRISPR GTCTGTGTGGACCAAAGGGA GGG (reversed) Intergenic
No off target data available for this crispr