ID: 1141477666

View in Genome Browser
Species Human (GRCh38)
Location 16:84284444-84284466
Sequence CTAAAGGCCGATTGTGCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141477655_1141477666 14 Left 1141477655 16:84284407-84284429 CCATTCACAGCCGGGAACAGGGC No data
Right 1141477666 16:84284444-84284466 CTAAAGGCCGATTGTGCAATGGG No data
1141477661_1141477666 4 Left 1141477661 16:84284417-84284439 CCGGGAACAGGGCTGGGCGGGGC No data
Right 1141477666 16:84284444-84284466 CTAAAGGCCGATTGTGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141477666 Original CRISPR CTAAAGGCCGATTGTGCAAT GGG Intergenic
No off target data available for this crispr