ID: 1141478754

View in Genome Browser
Species Human (GRCh38)
Location 16:84292304-84292326
Sequence CTCAAATGGAACCTGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141478747_1141478754 4 Left 1141478747 16:84292277-84292299 CCCCAGGTTCCAAGCAGCAGGAA No data
Right 1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG No data
1141478750_1141478754 -5 Left 1141478750 16:84292286-84292308 CCAAGCAGCAGGAAGTTTCTCAA No data
Right 1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG No data
1141478749_1141478754 2 Left 1141478749 16:84292279-84292301 CCAGGTTCCAAGCAGCAGGAAGT No data
Right 1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG No data
1141478748_1141478754 3 Left 1141478748 16:84292278-84292300 CCCAGGTTCCAAGCAGCAGGAAG No data
Right 1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG No data
1141478744_1141478754 22 Left 1141478744 16:84292259-84292281 CCTTAGGAGAGCGCAGGGCCCCA No data
Right 1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141478754 Original CRISPR CTCAAATGGAACCTGGGCCA AGG Intergenic
No off target data available for this crispr