ID: 1141479361

View in Genome Browser
Species Human (GRCh38)
Location 16:84296057-84296079
Sequence GTGGAGGAGGCTATCATTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141479361 Original CRISPR GTGGAGGAGGCTATCATTTT TGG Intronic
902962727 1:19976316-19976338 ATGGAAGAGGCTTTCCTTTTGGG - Intronic
905187663 1:36208183-36208205 GTGGGGGAGGCTGTCAGCTTTGG - Intergenic
906625147 1:47318897-47318919 CTGGGTGAGGCTATGATTTTAGG + Intergenic
907804874 1:57808389-57808411 GTGGAGGAAGCTATCAGTTGAGG - Intronic
910838035 1:91535234-91535256 GTGGATGACACTTTCATTTTTGG - Intergenic
912822147 1:112876565-112876587 GAGCTGGAGGCTATCATTCTTGG + Intergenic
914512638 1:148347357-148347379 GTGTAGGAGGAATTCATTTTTGG - Intergenic
915059398 1:153168146-153168168 GTGGAAGAGTCTATTCTTTTTGG - Intergenic
915736586 1:158089242-158089264 GTGAAGGCTGCAATCATTTTAGG - Intronic
918435345 1:184505239-184505261 GGGGAAGAGGGTAACATTTTTGG - Intronic
920767886 1:208850952-208850974 GTTGAGCAGGCTATCACTTTGGG + Intergenic
921388079 1:214590737-214590759 GTGAACGAGGATATCATTTACGG + Intergenic
1068308926 10:55254347-55254369 TTGGAAGAGGCTATTTTTTTAGG + Intronic
1069918892 10:71804150-71804172 GTAGAGGAGTCTGTCCTTTTTGG - Intronic
1071307118 10:84309315-84309337 GTGGAAGAGGCTAAATTTTTAGG - Intergenic
1073605057 10:104886200-104886222 GAGGTGGAGGCTTTTATTTTGGG + Intronic
1074543956 10:114388054-114388076 ATGAAGGAGGATATTATTTTAGG + Intronic
1075162135 10:120033724-120033746 GCGGAGGTGGCTCTCATCTTGGG - Intergenic
1076219225 10:128719570-128719592 GTGGAGGAAGGGATCATTTAGGG - Intergenic
1078854921 11:15199416-15199438 GCGCATGAGCCTATCATTTTGGG + Intronic
1080202109 11:29684227-29684249 GTGAAGGAGGGTATGATTTTGGG + Intergenic
1080353947 11:31419622-31419644 GTGGAGCAGTCTAAGATTTTAGG + Intronic
1081128841 11:39351362-39351384 GTGTAGGATGTTAACATTTTGGG - Intergenic
1084604149 11:70162655-70162677 GTGGAGGAGGCAGCCTTTTTGGG - Intronic
1087479616 11:98682220-98682242 GTGGAAGAGTTTATCATTTTAGG - Intergenic
1089231383 11:116980185-116980207 GTGGACCAGGCTATGATGTTTGG - Intronic
1097489025 12:60241017-60241039 GTGGAGCTGGCTACCATATTTGG - Intergenic
1098117204 12:67192167-67192189 GTGGAGGGGGCAGTAATTTTAGG - Intergenic
1100543249 12:95577955-95577977 GAGGAGGAGGCAGTTATTTTGGG - Intergenic
1101453030 12:104798471-104798493 CTGGAGGAGGTTTTTATTTTTGG + Intergenic
1102367351 12:112349774-112349796 GTGTAGGAGGATTTTATTTTTGG + Intronic
1110611192 13:77490049-77490071 GTGGAGGCGGCAACCATATTTGG + Intergenic
1112764734 13:102728795-102728817 CTGTAGGAGGCTTTCATGTTGGG - Intergenic
1113157578 13:107341259-107341281 GTGGAGTGGTCTTTCATTTTTGG + Intronic
1115443293 14:33460895-33460917 GAGGAGGAGGGTAACATTATTGG + Intronic
1117928686 14:60813500-60813522 GTAGAAGATGCTAACATTTTAGG + Intronic
1131864857 15:96697048-96697070 CTGGAGGATGCTAGCAGTTTTGG - Intergenic
1132170386 15:99646052-99646074 TTGTAAGAGACTATCATTTTTGG + Intronic
1132437818 15:101824654-101824676 CTGGCGGAGGCTGCCATTTTGGG + Intergenic
1133663372 16:7940871-7940893 GTGAAGAAGGCTATAACTTTAGG + Intergenic
1135831278 16:25776024-25776046 GAGGAGGAGGCTAACTTCTTTGG - Intronic
1138330844 16:56214193-56214215 GTGGAGGAGGCTCTCATTGCTGG + Intronic
1139380451 16:66527309-66527331 GGGGCAGAGGCTCTCATTTTGGG + Intronic
1141479361 16:84296057-84296079 GTGGAGGAGGCTATCATTTTTGG + Intronic
1143116860 17:4585887-4585909 CTGGAGGAGGGTATCAGATTGGG + Intronic
1144041654 17:11416797-11416819 GGGGAGAAAGCTAACATTTTGGG + Intronic
1145741168 17:27275850-27275872 GTGGAGGGGGTTACCATGTTGGG + Intergenic
1149725198 17:58886040-58886062 GTGGAGGAAGCTATAATCTCAGG - Intronic
1152730524 17:81967546-81967568 GAGGCCGAGGCTGTCATTTTTGG + Intergenic
1155569496 18:27176148-27176170 GTGGAGGAGGCTGTCCTTGCTGG + Intronic
1156132612 18:33995909-33995931 GTGGAGTAGTCTATCCTATTAGG + Intronic
1161882965 19:6970520-6970542 GGGGAAGAGGCTTGCATTTTTGG - Intergenic
1167486465 19:49766010-49766032 CTGGAGGAGACAATCAATTTTGG + Intergenic
925785533 2:7428928-7428950 GTGGAGGAGGCTGACCTTTGAGG + Intergenic
925790737 2:7484442-7484464 GTGCAGGATGTTATCATTTAGGG + Intergenic
929903946 2:46029833-46029855 GTGGAGGAGGAAATGATGTTTGG + Intronic
930401435 2:50894760-50894782 GTGGCAGAGGATATCATTTGAGG + Intronic
932802043 2:74749602-74749624 GTGCAGCAGGCTGTCAGTTTAGG + Intergenic
935334610 2:102004931-102004953 CTGGAGGAGGACAGCATTTTAGG + Intronic
936660979 2:114543341-114543363 GTGGAGGATGCTGTCAATGTTGG - Intronic
938664514 2:133520648-133520670 GCAGATGAGGCTGTCATTTTGGG + Intronic
939668169 2:144976491-144976513 TTGGAGGATGTTTTCATTTTAGG + Intergenic
939852386 2:147317485-147317507 AGGGAGGAGGCAATGATTTTTGG - Intergenic
942176633 2:173340892-173340914 TTTTAGGAGGCTATGATTTTAGG - Intergenic
942551378 2:177123187-177123209 GGGGAGGAGGCTAGGACTTTAGG - Intergenic
943732722 2:191319994-191320016 TTAGAGGAGTCTCTCATTTTTGG - Intronic
944711611 2:202339903-202339925 GTGGAGGAGACAACCAATTTAGG + Intergenic
946521333 2:220468024-220468046 GTGGACAAGGCTGGCATTTTGGG + Intergenic
946953549 2:224903832-224903854 TTGGAGGAGGTTTTCATATTTGG + Intronic
947487901 2:230569341-230569363 GTGGAGAAGGCTACAACTTTAGG + Intergenic
948524572 2:238563167-238563189 GTGGAGGAGGCTTGCCTTTGGGG - Intergenic
1169319146 20:4616888-4616910 GTTGCTGAGGCTTTCATTTTGGG + Intergenic
1175141936 20:56867245-56867267 GTGGGGGAGGCTGTCTCTTTGGG - Intergenic
1177924053 21:27191401-27191423 GAGGAGGAAGCTAGCAGTTTGGG + Intergenic
1177938588 21:27381271-27381293 GGGGAGGATGCTATAATTTCTGG + Intergenic
1179475632 21:41641712-41641734 GTGGTGGATGCTAACATTTTGGG + Intergenic
1185286402 22:50001762-50001784 GTGGAGCTGGGTATCATTTTGGG + Intronic
949409971 3:3753138-3753160 GTTGAGGGAGCTAGCATTTTAGG - Intronic
949761822 3:7479201-7479223 GATGAGGAGGCTATCACTCTGGG + Intronic
962393628 3:134994477-134994499 GTGGAAGAGGCTATGACTTGAGG - Intronic
963237803 3:142972692-142972714 GGTGAGGGGGCTATCAGTTTAGG - Intronic
963447590 3:145434331-145434353 GTGGGGGAGGGTGTTATTTTAGG + Intergenic
965121696 3:164567377-164567399 CTAGAGGAGGCTATCATGGTTGG - Intergenic
965331954 3:167386264-167386286 ATGCAGGAGTGTATCATTTTTGG - Intergenic
966146663 3:176820786-176820808 GTGGGGGAGGCTAGAATTTGAGG - Intergenic
974189217 4:58482119-58482141 GTGGAGGAGACTTTCATCTGCGG + Intergenic
974527279 4:63060480-63060502 ATGGAGGAGGTGATAATTTTGGG - Intergenic
975577003 4:75873229-75873251 GAGGAGGAGGCTGTTATTTTGGG - Exonic
980896534 4:138865840-138865862 GAGGAGGAGGATAGTATTTTGGG - Intergenic
981008807 4:139903345-139903367 TTGGAGTAGGCTATTATATTGGG - Intronic
985175961 4:187201513-187201535 GTGGAGCAGACTATCATTTTGGG - Intergenic
986935735 5:12883748-12883770 GAGGAGGAGGGTACCATTTCAGG - Intergenic
988896239 5:35677635-35677657 GAGTAGGAACCTATCATTTTGGG + Intronic
991254795 5:64602098-64602120 GAGGAGGATGCTATGAGTTTGGG - Intronic
996826141 5:127683430-127683452 TAGGAGGAGGGTATCATTTGGGG + Intergenic
998737314 5:145157330-145157352 GTGGTAGAGGATATAATTTTAGG - Intergenic
1000501734 5:162060349-162060371 TTATAGGAGGCTATTATTTTGGG + Intergenic
1002934735 6:1661904-1661926 ATGGAGGAGGCTATCATCTGAGG + Intronic
1003826344 6:9956462-9956484 GGGTAGGAGGGCATCATTTTAGG + Intronic
1006591828 6:35163768-35163790 ATGGAGGTGGCTTTCTTTTTGGG + Intergenic
1007038343 6:38699041-38699063 GTGGAAGAGGCTAACATGGTAGG - Intronic
1007884822 6:45215138-45215160 GTTGAGTAGGCTTTGATTTTTGG - Intronic
1008367492 6:50699493-50699515 GTGCAGGGGGCTAGCATTCTAGG + Intergenic
1009508619 6:64519098-64519120 GTGGAAGAGGCTATGATACTGGG + Intronic
1009513778 6:64587663-64587685 CTGGTGCTGGCTATCATTTTAGG + Intronic
1017600960 6:156080798-156080820 GTGGAGTAGGCTATCCATCTAGG + Intergenic
1020696022 7:11414737-11414759 GAGGAGGAAGCAATTATTTTAGG - Intronic
1021660724 7:22915945-22915967 GTGAAGGAGGCTTTGAATTTGGG - Intergenic
1029339757 7:99933389-99933411 GGGTAGGAGGCTATCATATAGGG - Intergenic
1031116061 7:117670153-117670175 ATGGGGGAGGCTATCATGTATGG - Intronic
1031695001 7:124840079-124840101 CTGGAGGAGGCTAGCATGTATGG - Intronic
1034352128 7:150423479-150423501 GTGGGGGAGGCTATGCTTGTGGG - Intergenic
1035852622 8:2936022-2936044 GTGTTGGAGGATCTCATTTTAGG - Intronic
1037135012 8:15449988-15450010 GTGCAGGAGGCTATCCCTCTAGG + Intronic
1041421772 8:57674829-57674851 GTGGCGGAGGCTATCTTTTGAGG + Intergenic
1042273159 8:66976367-66976389 GTGGAGGGGGATATTGTTTTGGG - Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1045854410 8:106747369-106747391 GTAAAGGTGGCTATCAGTTTAGG - Intronic
1046411825 8:113855004-113855026 GAGGATGAGGCTATCAATATAGG - Intergenic
1046884316 8:119346841-119346863 ATGGAGGAGGCTATACATTTGGG - Intergenic
1047638676 8:126795032-126795054 GTGGAGGAAGCCATCATGTATGG - Intergenic
1051480091 9:17550245-17550267 GTGGAAGGGGCTAGCTTTTTGGG + Intergenic
1051782624 9:20706826-20706848 GTGCAGCAAGCTATCATTTAGGG + Intronic
1052413963 9:28154124-28154146 GCTGAGGAGACTATCTTTTTGGG + Intronic
1053086261 9:35225676-35225698 GTGGTGTAGGCTATAATTGTTGG + Intronic
1053456774 9:38239052-38239074 GTGGAAGAGCCTGTCCTTTTGGG - Intergenic
1055344323 9:75318347-75318369 GTGGATGTGGCTACCATTTCAGG - Intergenic
1055806086 9:80095323-80095345 GTGCAGGAGGCAATAATTCTTGG + Intergenic
1056736751 9:89216171-89216193 GTGGAGGAGGAAATATTTTTAGG - Intergenic
1058059593 9:100481113-100481135 GTGGAGAAGGCTGTAATTTAAGG - Intronic
1058775986 9:108284329-108284351 GTGGAGGAGACAAACTTTTTAGG - Intergenic
1060257274 9:122043160-122043182 GTGGGGGAGGCTATCAATGCAGG + Intronic
1186256703 X:7729696-7729718 GAGGATGTGGCTCTCATTTTAGG - Intergenic
1186817572 X:13252975-13252997 GTGAAGCAGGCCATCATATTGGG + Intergenic
1186828692 X:13367804-13367826 GAAGAAGAGGCTAACATTTTTGG + Intergenic
1186918171 X:14246157-14246179 ATGGAGGAAGCTAGTATTTTGGG - Intergenic
1188055856 X:25540673-25540695 GTGGAGAAGGTTTTCATTCTAGG - Intergenic
1189704078 X:43742654-43742676 TGGTAGGAGGCTATCACTTTGGG - Intronic
1192199747 X:69059241-69059263 CTGAGGGAGGCTATAATTTTTGG - Intergenic
1195138839 X:101938342-101938364 GAGGAGAAAGCTATCATTCTGGG + Intergenic
1195579396 X:106484187-106484209 GTGCAGGTGGCTATGATTGTAGG - Intergenic
1196254777 X:113504062-113504084 GTGGGGGAGGAAATCATTTCAGG + Intergenic
1196489444 X:116249327-116249349 AGGGAGGAGGCAATGATTTTTGG - Intergenic
1197614446 X:128675704-128675726 GTGCAGGATGATGTCATTTTGGG - Intergenic
1200776713 Y:7176085-7176107 ATGGAGGAGGTGATGATTTTTGG - Intergenic
1201011561 Y:9551955-9551977 GGGGAGGAGGATTTCATTGTTGG + Intergenic
1201061104 Y:10047574-10047596 GTTGAGGAGGCAAAAATTTTGGG + Intergenic