ID: 1141481133

View in Genome Browser
Species Human (GRCh38)
Location 16:84307739-84307761
Sequence GGCGCCCCAGCCTCCTTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141481133_1141481135 -6 Left 1141481133 16:84307739-84307761 CCTCCGAAGGAGGCTGGGGCGCC No data
Right 1141481135 16:84307756-84307778 GGCGCCTGTCATGTTAGATTAGG 0: 1
1: 0
2: 0
3: 24
4: 256
1141481133_1141481137 8 Left 1141481133 16:84307739-84307761 CCTCCGAAGGAGGCTGGGGCGCC No data
Right 1141481137 16:84307770-84307792 TAGATTAGGATTAAAAATTGCGG 0: 1
1: 0
2: 1
3: 29
4: 293
1141481133_1141481139 21 Left 1141481133 16:84307739-84307761 CCTCCGAAGGAGGCTGGGGCGCC No data
Right 1141481139 16:84307783-84307805 AAAATTGCGGACCCCAACATGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1141481133_1141481138 20 Left 1141481133 16:84307739-84307761 CCTCCGAAGGAGGCTGGGGCGCC No data
Right 1141481138 16:84307782-84307804 AAAAATTGCGGACCCCAACATGG 0: 1
1: 0
2: 0
3: 5
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141481133 Original CRISPR GGCGCCCCAGCCTCCTTCGG AGG (reversed) Intronic
No off target data available for this crispr