ID: 1141482828

View in Genome Browser
Species Human (GRCh38)
Location 16:84318292-84318314
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 47}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141482828_1141482834 -2 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482834 16:84318313-84318335 GGCAATGGCTGGCTCCTGGATGG 0: 1
1: 0
2: 2
3: 23
4: 275
1141482828_1141482836 9 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482836 16:84318324-84318346 GCTCCTGGATGGCCCTGAGGAGG 0: 1
1: 1
2: 1
3: 26
4: 246
1141482828_1141482842 30 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482842 16:84318345-84318367 GGTGTTACAAGGTACCTGCCGGG 0: 1
1: 0
2: 0
3: 5
4: 55
1141482828_1141482833 -6 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482833 16:84318309-84318331 TGGTGGCAATGGCTGGCTCCTGG 0: 1
1: 0
2: 2
3: 20
4: 282
1141482828_1141482835 6 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482835 16:84318321-84318343 CTGGCTCCTGGATGGCCCTGAGG 0: 1
1: 0
2: 6
3: 71
4: 470
1141482828_1141482838 19 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482838 16:84318334-84318356 GGCCCTGAGGAGGTGTTACAAGG 0: 1
1: 0
2: 2
3: 19
4: 136
1141482828_1141482841 29 Left 1141482828 16:84318292-84318314 CCGAAACCTCGATGGCTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 47
Right 1141482841 16:84318344-84318366 AGGTGTTACAAGGTACCTGCCGG 0: 1
1: 0
2: 2
3: 3
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141482828 Original CRISPR CCACCAAGCCATCGAGGTTT CGG (reversed) Exonic